ID: 994009677

View in Genome Browser
Species Human (GRCh38)
Location 5:94886131-94886153
Sequence CTATAGGCTTTTTGTGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 482}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994009672_994009677 7 Left 994009672 5:94886101-94886123 CCTACTGTAGTAGTGTTCAGCTG 0: 1
1: 0
2: 0
3: 13
4: 135
Right 994009677 5:94886131-94886153 CTATAGGCTTTTTGTGGAAAGGG 0: 1
1: 0
2: 0
3: 24
4: 482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994009677 Original CRISPR CTATAGGCTTTTTGTGGAAA GGG Intronic
909473758 1:76058861-76058883 ATATAGGTTTTTTGGGGAACAGG - Intergenic
910214083 1:84824620-84824642 CAACAGGATTTTTGTGAAAATGG + Intronic
910694758 1:90000382-90000404 CTATATGCTATTTATGTAAAAGG - Intronic
911903719 1:103538156-103538178 TTAAAGTTTTTTTGTGGAAATGG + Intronic
912181173 1:107220810-107220832 CTATACCCTTCCTGTGGAAAAGG + Intronic
912284519 1:108354820-108354842 CAATAGGCTTTTTGGGGAACAGG - Intergenic
913807535 1:122823645-122823667 CTTGAGGCTTTTGTTGGAAACGG + Intergenic
913808654 1:122844051-122844073 CTAGAGGCTTTCGTTGGAAACGG + Intergenic
913820426 1:123054118-123054140 CTTGAGGCTTTCTTTGGAAACGG + Intergenic
913836810 1:123347938-123347960 CTTGAGGCTTTCTTTGGAAAAGG + Intergenic
913840286 1:123410122-123410144 CTTGAGGCTTTCTTTGGAAACGG + Intergenic
913854439 1:123664525-123664547 CTAGAGGCTTTCGTTGGAAACGG + Intergenic
913871176 1:123964633-123964655 ATTGAGGCTTTTTTTGGAAACGG + Intergenic
913875559 1:124043807-124043829 CTTGAGGCTTTCTTTGGAAACGG + Intergenic
913877230 1:124073406-124073428 CTTGAGGCTTTTGTTGGAAACGG + Intergenic
913903519 1:124544396-124544418 CTTGAGGCCTTTTTTGGAAACGG + Intergenic
913936536 1:125058376-125058398 TTTGAGGCCTTTTGTGGAAAAGG + Intergenic
915981530 1:160423208-160423230 CTATATGCTTTTAATGTAAATGG + Intronic
917639540 1:176969612-176969634 CAATATTCATTTTGTGGAAAGGG + Intronic
918566954 1:185945483-185945505 TTATAGGCTTTTTGAGGAGATGG - Intronic
918744838 1:188186018-188186040 CCACAGGCTTTTTGGGGAAGTGG - Intergenic
919332977 1:196194536-196194558 CTAAAGCCTTGTTGTGGAAGAGG + Intergenic
919616368 1:199813822-199813844 CTACAGGCTTTTTCTCTAAAAGG + Intergenic
921433029 1:215084236-215084258 TTATATGCTTTTTGGGGAAAGGG - Intronic
921470768 1:215546197-215546219 CTAAAGGCTTTTTGTGGTGAGGG - Intergenic
922319438 1:224472762-224472784 CAATAGGATTTTTGGGGAACAGG - Intronic
923383189 1:233442006-233442028 CTGTATGGTATTTGTGGAAAGGG - Intergenic
1063423112 10:5929556-5929578 CTGTAGACTTTTTCTGTAAAGGG + Intronic
1063951605 10:11228375-11228397 CAATAGGCTTCTAGTTGAAAAGG - Intronic
1064308293 10:14188170-14188192 TTCCAGGCATTTTGTGGAAAAGG - Intronic
1066784411 10:38987307-38987329 CCATAGGTTTTTTGGGGAACAGG + Intergenic
1066808532 10:39291992-39292014 CAAGAGGCCTTTGGTGGAAAAGG - Intergenic
1066818526 10:39453789-39453811 ATTGAGGCCTTTTGTGGAAAAGG - Intergenic
1066819997 10:39473470-39473492 TTTGAGGCTTATTGTGGAAAAGG - Intergenic
1066820191 10:39476689-39476711 TTTGAGGCCTTTTGTGGAAAAGG - Intergenic
1067400464 10:45968947-45968969 CTATAGACTTTTTGTGAAAGTGG - Intergenic
1067868808 10:49938504-49938526 CTATAGACTTTTTGTGAAAGTGG - Intronic
1069374928 10:67784079-67784101 CTATGGGCTCTTTGAGGGAAGGG + Intergenic
1071257192 10:83881385-83881407 GTATAGGCTACTTCTGGAAAGGG + Intergenic
1071706718 10:88007121-88007143 CTAAAGGCTTCCTGTAGAAAGGG + Intergenic
1071792809 10:88973709-88973731 CTAGATGATTTTTTTGGAAAAGG - Intronic
1071811781 10:89189989-89190011 CCATATGTTTTTTGAGGAAAAGG + Intergenic
1072339044 10:94428456-94428478 TTTTATACTTTTTGTGGAAATGG + Intronic
1072444356 10:95485346-95485368 TTTTAGGCTTTTTGGGTAAAGGG - Intronic
1075521146 10:123144322-123144344 CAATAGGCTTTTGGGGAAAAGGG - Intergenic
1075838432 10:125476323-125476345 CCGTAGGCTTTTTGTGGAGGGGG + Intergenic
1076353822 10:129838202-129838224 TTAAAGGCTTCTTTTGGAAAAGG + Intronic
1079647812 11:22889394-22889416 CAATAGGATTTTTGGGGAACAGG + Intergenic
1080025324 11:27607663-27607685 CTAGAGGCTTTTTTGGGAAGTGG + Intergenic
1080550902 11:33373440-33373462 CTGTAGGCTTCTTGAGGAAAGGG + Intergenic
1081400786 11:42640209-42640231 CCATAGTCTTTTTCTGGAAGTGG - Intergenic
1081462557 11:43285379-43285401 CTTTAGGATTTTTGTGACAATGG - Intergenic
1082318148 11:50756767-50756789 TTTCAGGCTTGTTGTGGAAAAGG - Intergenic
1082319659 11:50786070-50786092 TTTTAGGCCTATTGTGGAAAAGG - Intergenic
1082319881 11:50790166-50790188 CTTGAGGCCTATTGTGGAAAAGG - Intergenic
1082581482 11:54874981-54875003 CTAGAGGCCTATTGTGAAAAAGG - Intergenic
1083001583 11:59297219-59297241 CTCTAGGCTTCTTCTGGGAAGGG - Intergenic
1083433891 11:62629807-62629829 CTATGGCCTTTATGTGGTAAGGG - Exonic
1084648394 11:70473973-70473995 CCTTAGGCTTTTTGGGTAAATGG + Intronic
1085902759 11:80721607-80721629 TTAAAGGCTTTCTGTGGAAGAGG - Intergenic
1087246610 11:95846044-95846066 CTATAAGCATATTCTGGAAATGG + Intronic
1087982447 11:104632689-104632711 CTGTAAGCTCTTTGAGGAAAGGG + Intergenic
1088129897 11:106474897-106474919 TTATAAGCTATTTGTGGTAAAGG + Intergenic
1089758501 11:120705534-120705556 CTAGTGGCTTTTTATAGAAATGG - Intronic
1090067970 11:123519428-123519450 AAAGAGGCTTGTTGTGGAAATGG + Intergenic
1090725783 11:129526223-129526245 CTAGAGGATTTTTCTGTAAAGGG - Intergenic
1093399664 12:18729718-18729740 CAATAGGCTTTTTTAGTAAAGGG + Intronic
1095057572 12:37632329-37632351 TTTGAGGCCTTTTGTGGAAAAGG - Intergenic
1095058803 12:37656082-37656104 TTTGAGGCCTTTTGTGGAAAAGG + Intergenic
1095059933 12:37673174-37673196 TTTGAGGCCTTTTGTGGAAAAGG - Intergenic
1095062763 12:37720347-37720369 TTGTAGGCCTATTGTGGAAAAGG + Intergenic
1095063270 12:37730432-37730454 TTGCAGGCTTTTAGTGGAAAAGG + Intergenic
1095540193 12:43300897-43300919 CAAAAGGTATTTTGTGGAAAAGG + Intergenic
1098847454 12:75555270-75555292 ATATAGGCTTTTTCAGGCAAAGG - Intergenic
1099355407 12:81628887-81628909 CTATAGGCCTTATGTGCAATTGG - Intronic
1100629223 12:96370361-96370383 CCATAGGCTTTGATTGGAAAAGG - Intronic
1102370304 12:112377417-112377439 TTATAAGCTTTTTGAGGACAAGG + Intronic
1102994301 12:117336614-117336636 CAATAGGTTTTTTGGGGAACAGG - Intronic
1103108314 12:118251088-118251110 CTAAAGGCTTTATAGGGAAAGGG + Intronic
1103281662 12:119762866-119762888 TTTTATACTTTTTGTGGAAATGG - Intronic
1105670487 13:22608207-22608229 TTATATGCTTTATCTGGAAATGG - Intergenic
1107824981 13:44320602-44320624 CTAGAAACTTTTTCTGGAAAAGG + Intergenic
1107862515 13:44674417-44674439 TTTTATGCTTTTTGTAGAAATGG + Intergenic
1111726476 13:92016179-92016201 GTACAGACTTTTGGTGGAAAGGG + Intronic
1113493467 13:110711105-110711127 TTATATGCTTTTTGAGGGAAAGG + Intronic
1114504915 14:23202993-23203015 CCATAGGTTTTTTGGGGAACAGG + Intronic
1115226996 14:31113468-31113490 CTATAGGATTTTTGTGAGCATGG - Exonic
1115890041 14:38016425-38016447 TTATAGGTTTGTGGTGGAAATGG + Intronic
1116117349 14:40671942-40671964 ATATAAGCTTTATGTGGCAAAGG - Intergenic
1117783193 14:59255994-59256016 CTAGAGGGGTTTAGTGGAAATGG - Intronic
1118537978 14:66790433-66790455 CTCTAGGCTTTTTCTGGGAAGGG - Intronic
1120450466 14:84660192-84660214 CAATAGGCTTTTGGGGGAACAGG + Intergenic
1121908576 14:97769077-97769099 CTACAGGTTTTTTGGGGAACAGG + Intergenic
1123179682 14:106458046-106458068 TTATAGACTTTTTTTGGTAAGGG - Intergenic
1123226968 15:17048533-17048555 TTAAAGGCCTATTGTGGAAACGG + Intergenic
1123400887 15:19984925-19984947 TTATAGACTTTTTTTGGTAATGG - Intergenic
1126753762 15:51904296-51904318 CTATATGCTTTTTGAGGGCAGGG + Intronic
1126762109 15:51978767-51978789 TTATAGGGTTGTTGTGAAAATGG - Intronic
1127001930 15:54518903-54518925 CTATTGGCTAATTGTGAAAATGG - Intronic
1128753790 15:70167233-70167255 CAATAAACTTTTTCTGGAAAAGG - Intergenic
1128906891 15:71475287-71475309 AAATAGCATTTTTGTGGAAAAGG + Intronic
1131625490 15:94115180-94115202 TTATACGCTGTTGGTGGAAATGG + Intergenic
1136450680 16:30352854-30352876 CTAAAGGCTTTTATTGGGAAAGG + Exonic
1136906787 16:34100085-34100107 CTTGAGGCCTATTGTGGAAAAGG - Intergenic
1136918747 16:34243791-34243813 CTTGAGGCTTTCTTTGGAAACGG + Intergenic
1137080978 16:36053595-36053617 TTTTAGGCCTATTGTGGAAACGG + Intergenic
1137081715 16:36068737-36068759 TTAGAGGCCTATTGTGGAAAAGG + Intergenic
1138614628 16:58155329-58155351 CTATATGATGTTTTTGGAAAGGG - Intergenic
1138883707 16:61049348-61049370 CAATAGGTTTTTGGAGGAAAAGG + Intergenic
1139580233 16:67868873-67868895 CTAGAGCCTTTATCTGGAAAAGG + Intronic
1143985176 17:10907038-10907060 CTGTAGGTTTCATGTGGAAAAGG + Intergenic
1145686507 17:26673413-26673435 TTTTAGGCTTGTGGTGGAAAAGG + Intergenic
1148825535 17:50390791-50390813 CTTTAGGCTTTGTAGGGAAATGG - Intronic
1150469939 17:65428664-65428686 CTATAGGTTTTTGGGGGAACAGG - Intergenic
1151874686 17:76860719-76860741 CCAGAGGGTTTTTGTGGCAAGGG - Intergenic
1154341594 18:13507183-13507205 CAATAGGTTTTTTGGGGAACAGG + Intronic
1155133009 18:22957332-22957354 CTATAAGCTTTTTAAAGAAATGG + Intronic
1155220484 18:23680942-23680964 CTGTAGACTTTTTGAGGACAGGG - Intergenic
1155569749 18:27179571-27179593 CTATTGGCTTTTAGTGTATATGG + Intronic
1156647501 18:39183943-39183965 TTAGAGGCTTTTTCTGGGAAAGG - Intergenic
1157108532 18:44798012-44798034 CTATATGCTTTTAGTAGAACAGG - Intronic
1157831768 18:50862593-50862615 CTGCAGGCTGCTTGTGGAAATGG + Intergenic
1159132144 18:64291252-64291274 TTATAGTTTTTTTGTAGAAACGG + Intergenic
1160042602 18:75359431-75359453 CTATAAGCTTTATGAGGATAGGG + Intergenic
1164340589 19:24393809-24393831 CTTGAGGCGTATTGTGGAAAAGG + Intergenic
1164341365 19:24402981-24403003 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1164341381 19:24403418-24403440 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1164348525 19:27300084-27300106 TTTGAGGCGTTTTGTGGAAAAGG + Intergenic
1164349255 19:27314328-27314350 TTTGAGGCCTTTTGTGGAAAAGG + Intergenic
1164349447 19:27317921-27317943 TTTGAGGCCTTTTGTGGAAAGGG + Intergenic
1164349812 19:27323000-27323022 TTTGAGGCTTATTGTGGAAAAGG + Intergenic
1164353152 19:27378324-27378346 TTTGAGGCCTTTTGTGGAAAAGG + Intergenic
1164365366 19:27575364-27575386 CTAGAGGCTTATGGTGAAAAAGG + Intergenic
1165640439 19:37380761-37380783 GTATAGGCTTTTTGGTGCAAAGG - Intronic
1166335683 19:42105532-42105554 CTCTAGGCTTCTGGAGGAAAGGG - Intronic
1167882549 19:52472471-52472493 CTATAGTCTTATTTTTGAAATGG - Intronic
925295551 2:2774117-2774139 CCATAGGCTGTCTGGGGAAATGG + Intergenic
925961737 2:9023513-9023535 CAATAGGTTTTTTGGGGAACAGG - Intergenic
928763606 2:34614140-34614162 ATCTAGGCATTTTGTGGACAAGG - Intergenic
930662392 2:54067849-54067871 TTATAGCCTTTATTTGGAAAAGG - Intronic
931293501 2:60898824-60898846 CTGTAAGCTTCTTGAGGAAAGGG + Intronic
934472356 2:94561946-94561968 TTAGAGGCTTATGGTGGAAAAGG - Intergenic
935037366 2:99391673-99391695 CTGTAGACTTTATGTAGAAATGG + Intronic
936928635 2:117763777-117763799 CTATAAGCTTCTTGTGGACATGG - Intergenic
938534679 2:132228061-132228083 TTTTAGGCTTATGGTGGAAAAGG + Intronic
939148073 2:138440613-138440635 CTAAAGGATTTTTCTGAAAAGGG - Intergenic
939197549 2:138991233-138991255 CTCTAGGCTCTTTCTGGGAAGGG + Intergenic
941462731 2:165790769-165790791 ATGTAGTCTTTTTGTGGAGAGGG + Intronic
941492874 2:166163981-166164003 CTGTAGGCTCTGTGAGGAAAGGG + Intergenic
942296038 2:174518114-174518136 CTGTAAGCTTTTTCTGAAAAGGG - Intergenic
942766663 2:179465396-179465418 CTATAGAGTATTGGTGGAAAAGG - Intronic
943492561 2:188574147-188574169 GTATAGTCTCTTTGGGGAAAGGG + Intronic
944072686 2:195690868-195690890 CAATAGGTTTTTTGGGGAACAGG + Intronic
944643624 2:201754793-201754815 CTAGAGGCTCTCTGTAGAAAAGG + Intronic
946298298 2:218804565-218804587 CCATAGCCTTTTTGCAGAAATGG - Intronic
946411659 2:219518189-219518211 CTATAGGCTGCTTGAGGACAGGG - Intronic
946462673 2:219883174-219883196 CCATAGGTTTTTTGGGGAACAGG + Intergenic
946958116 2:224954304-224954326 CTATAATTTTTTTCTGGAAATGG - Intronic
947166046 2:227263496-227263518 CTATAGTCTTTTTATTTAAAAGG - Intronic
1169684163 20:8251768-8251790 CTGAAGGCTTTTTGGGGAGAGGG - Intronic
1169716754 20:8628130-8628152 CTCTAGGCCATTTGTGGAATGGG + Intronic
1169767412 20:9162309-9162331 CCATAGACTTTTGGAGGAAAAGG + Intronic
1170040307 20:12033287-12033309 CTACAAGCTTTCTGTGGACATGG + Intergenic
1170483037 20:16787255-16787277 CAATAGGTTTTTTGGGGAACAGG + Intergenic
1170830241 20:19833456-19833478 ATATAGGTTTTATGTGGACACGG - Intergenic
1171728346 20:28649762-28649784 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171728455 20:28651800-28651822 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171728573 20:28653896-28653918 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171728685 20:28655894-28655916 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171728786 20:28657767-28657789 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171728885 20:28659639-28659661 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171728987 20:28661511-28661533 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171729090 20:28663384-28663406 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171729190 20:28665256-28665278 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171729289 20:28667128-28667150 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171729391 20:28669000-28669022 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171729493 20:28670874-28670896 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171729695 20:28674620-28674642 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171729794 20:28676492-28676514 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171729897 20:28678365-28678387 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171729997 20:28680237-28680259 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171730114 20:28682342-28682364 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171730214 20:28684214-28684236 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171730316 20:28686086-28686108 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171730418 20:28687959-28687981 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171730547 20:28690098-28690120 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171730648 20:28691970-28691992 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171730749 20:28693843-28693865 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171730925 20:28697027-28697049 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171731053 20:28699171-28699193 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171731152 20:28701043-28701065 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171731255 20:28702915-28702937 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171731462 20:28706834-28706856 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171731563 20:28708706-28708728 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171731664 20:28710578-28710600 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171731767 20:28712450-28712472 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171731868 20:28714324-28714346 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171731967 20:28716199-28716221 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171732080 20:28718243-28718265 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171732202 20:28720475-28720497 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171732301 20:28722351-28722373 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171732399 20:28724224-28724246 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171732578 20:28727633-28727655 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171735238 20:28773412-28773434 TTAGAGGCCTATTGTGGAAAAGG - Intergenic
1171736110 20:28787633-28787655 TTTGAGGCTTATTGTGGAAAAGG - Intergenic
1171743235 20:28929630-28929652 TTAAAGGCCTATTGTGGAAAAGG - Intergenic
1171744062 20:28945133-28945155 TTTGAGGGTTTTTGTGGAAAAGG + Intergenic
1171744126 20:28946500-28946522 TTTGAGGTTTTTTGTGGAAAAGG + Intergenic
1171744923 20:28961457-28961479 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171745022 20:28963329-28963351 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171745121 20:28965201-28965223 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171745220 20:28967073-28967095 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171745370 20:28969966-28969988 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171745470 20:28971838-28971860 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171745570 20:28973710-28973732 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171745669 20:28975582-28975604 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171745768 20:28977454-28977476 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171745867 20:28979326-28979348 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171745966 20:28981198-28981220 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171746065 20:28983070-28983092 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171746165 20:28984942-28984964 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171746264 20:28986814-28986836 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171746364 20:28988686-28988708 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171746463 20:28990558-28990580 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171746562 20:28992430-28992452 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171746662 20:28994302-28994324 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171746762 20:28996174-28996196 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171746862 20:28998046-28998068 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171746962 20:28999918-28999940 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171747063 20:29001790-29001812 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171747163 20:29003662-29003684 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171747262 20:29005534-29005556 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171747362 20:29007406-29007428 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171747462 20:29009278-29009300 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171747562 20:29011150-29011172 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171747662 20:29013022-29013044 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171759397 20:29161061-29161083 CTTGAGGCCTATTGTGGAAAGGG + Intergenic
1171760751 20:29187711-29187733 CTTGAGGCCTATTGTGGAAAGGG + Intergenic
1171761030 20:29193347-29193369 TTTGAGGCCTTTTGTGGAAAGGG + Intergenic
1171761425 20:29201033-29201055 TTTGAGGCTTATTGTGGAAAGGG + Intergenic
1171821173 20:29842095-29842117 TTTGAGGCTTATTGTGGAAAGGG + Intergenic
1171821973 20:29857271-29857293 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171822018 20:29858122-29858144 TTTTAGGCCTATTGTGGAAAAGG + Intergenic
1171822075 20:29859148-29859170 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1171822245 20:29862731-29862753 CTTGAGGCGTTTAGTGGAAAAGG - Intergenic
1171825844 20:29903548-29903570 CTTGAGGCTTATGGTGGAAAAGG + Intergenic
1171826094 20:29908324-29908346 TTAAAGGCTTATGGTGGAAAAGG + Intergenic
1171832356 20:30029872-30029894 TTTGAGGCTTATTGTGGAAAAGG + Intergenic
1171863623 20:30456369-30456391 TTAGAGGCCTATTGTGGAAAAGG + Intergenic
1171911128 20:30956090-30956112 TTTGAGGCCTTTTGTGGAAAAGG - Intergenic
1171911774 20:30968328-30968350 TTTTAGGCCTTTGGTGGAAAGGG - Intergenic
1172512773 20:35512136-35512158 CTGTAGGCTGTCTGTGGACAGGG - Exonic
1175148525 20:56914626-56914648 CTACAAGCTTTTTCTGTAAAGGG + Intergenic
1176318404 21:5276944-5276966 TTTGAGGCTTTTTGTGGAAAAGG - Intergenic
1176318603 21:5281372-5281394 TTTGAGGCTTATTGTGGAAAAGG - Intergenic
1176323620 21:5362421-5362443 TTAGAGGCCTATTGTGGAAAAGG + Intergenic
1176324127 21:5370663-5370685 TTTGAGGCCTTTTGTGGAAAAGG + Intergenic
1176476385 21:7216281-7216303 TTTGAGGCTTTTTGTGGAAAAGG - Intergenic
1176476579 21:7220709-7220731 TTTGAGGCTTATTGTGGAAAAGG - Intergenic
1176481380 21:7296424-7296446 TTAGAGGCCTATTGTGGAAAAGG + Intergenic
1176481887 21:7304670-7304692 TTTGAGGCCTTTTGTGGAAAAGG + Intergenic
1176886071 21:14257007-14257029 CTATAGGTTTTTGGGGGAACAGG + Intergenic
1177589189 21:23139762-23139784 CTATATGAATTTTCTGGAAATGG - Intergenic
1178973573 21:37202451-37202473 CAACAGGCTGTGTGTGGAAATGG + Exonic
1180325060 22:11363968-11363990 CTAGAGGACTATTGTGGAAAAGG + Intergenic
1180396086 22:12341298-12341320 TTTGAGGCTTTTTGGGGAAAAGG - Intergenic
1180399917 22:12405518-12405540 TTAGAGGCCTATTGTGGAAAAGG + Intergenic
1180400952 22:12424001-12424023 TTAAAGGCCTATTGTGGAAAAGG + Intergenic
1180403556 22:12521253-12521275 TTTGAGGCTTTTTGTGGAAAAGG + Intergenic
1180403663 22:12523466-12523488 TTTGAGGCTTTTTGGGGAAAAGG + Intergenic
1180506244 22:16009001-16009023 TTTTAGGCCTATTGTGGAAAAGG - Intergenic
1180526738 22:16272129-16272151 CTTTAGGCCTGTGGTGGAAAAGG + Intergenic
1181592356 22:23893322-23893344 CCATAGGCTATTTGTATAAATGG + Intronic
1182007869 22:26976168-26976190 CTAAAGGCATTTTGTAGATATGG + Intergenic
1182059080 22:27383973-27383995 CTCTATGCTCTGTGTGGAAAGGG - Intergenic
1203332412 22_KI270739v1_random:12767-12789 TTTTAGGCCTATTGTGGAAAAGG + Intergenic
949639506 3:6019316-6019338 CTATTAACTTTTTGTGGTAATGG + Intergenic
950317861 3:12020816-12020838 CTATAGGCTTTGTGAAGACAGGG - Intronic
951487405 3:23229306-23229328 CCATAGGTTTTTTGGGGAACAGG + Intronic
952331628 3:32368876-32368898 CGATAGGCTTCTTTTGGAGATGG - Intronic
953222592 3:40986291-40986313 CAGTAGGCTCTTTGTGGAAGTGG - Intergenic
955795084 3:62627847-62627869 ATAATGGCTTTTTGAGGAAAGGG - Intronic
956849902 3:73219339-73219361 CTATAGGCGCCTTGTGGACAGGG + Intergenic
957312503 3:78539130-78539152 CTATAGGTTTTTGGGGGAACAGG - Intergenic
957587958 3:82157007-82157029 CAATAGGCTTAATGTAGAAAAGG - Intergenic
958905088 3:99933230-99933252 CTATAGGCATTTTTCGGACAAGG - Intronic
960009241 3:112815368-112815390 CTCTGGGCTTGTTGTGGGAAGGG - Intronic
960145372 3:114195092-114195114 CTTTAGGCCTTTTGGGGAACAGG + Intronic
960524782 3:118697126-118697148 CTTTAGGATTTTTGAGGTAAAGG - Intergenic
963281658 3:143390395-143390417 CTATCTCCGTTTTGTGGAAAAGG - Intronic
964547461 3:157849832-157849854 CCATAAGCTTTTTGAAGAAAGGG + Intergenic
964981035 3:162679935-162679957 CTCTAAGTATTTTGTGGAAAAGG + Intergenic
965378167 3:167953296-167953318 CCATAGGTTTTTTGGGGAACAGG + Intergenic
965564696 3:170102383-170102405 CTCTAGCCCTTTTGTGCAAAAGG + Intronic
969030049 4:4204556-4204578 CTGTTGGCTTGATGTGGAAATGG + Intronic
969835416 4:9836276-9836298 CCATAGGTTTTTTGGGGAACAGG - Intronic
970626428 4:17889605-17889627 CTACAGGCTTTATGAAGAAAAGG - Intronic
970696098 4:18678925-18678947 CTATAGACTTTGTCTAGAAAGGG + Intergenic
971033881 4:22671436-22671458 CTACATGCTTTTTGTAGGAAAGG + Intergenic
971539534 4:27798408-27798430 CTATGGGCTTTCTGACGAAAAGG + Intergenic
971544331 4:27866417-27866439 CAATACGGTTTTTGTGAAAATGG - Intergenic
971853685 4:32016327-32016349 CTAGATGCTATTTGTGGACAGGG - Intergenic
972927757 4:44032775-44032797 CTATATTCTATTTGAGGAAAGGG + Intergenic
973006604 4:45015260-45015282 CTATACCCTATTGGTGGAAATGG - Intergenic
976238213 4:82923797-82923819 CTGTAGGCTTTTTTTGTAAATGG + Intronic
976613242 4:87051028-87051050 AGATAGGCTTTTTATTGAAAAGG + Intronic
976891090 4:90048690-90048712 CTATGAGCATTTAGTGGAAAGGG + Intergenic
979170441 4:117595357-117595379 CTCTAGTCTTTTTCTGGGAAGGG - Intergenic
980026037 4:127767887-127767909 CAATAGGTTTTTTGGGGAACAGG - Intronic
980070963 4:128242652-128242674 GTAAAGGCTTTTTGAAGAAAAGG + Intergenic
980142812 4:128941458-128941480 CTTTTGGCCTTTTCTGGAAATGG + Intronic
980306323 4:131065259-131065281 TCATAGGCTGTTTGTGGCAAGGG + Intergenic
980598822 4:134992178-134992200 CTATAAGCTTTATTTTGAAATGG + Intergenic
981589661 4:146345712-146345734 CTATAAGCTTTATGAGGAAAGGG + Intronic
981696155 4:147561278-147561300 CTGTAGGCTTTTTAAGAAAATGG + Intergenic
982781654 4:159497504-159497526 CTATAAGCTCTGTGAGGAAAGGG + Intergenic
982864204 4:160489653-160489675 CTCTAGGCTCTTTCTGGGAAAGG + Intergenic
984044105 4:174776118-174776140 CTATGGAATTTTTGAGGAAATGG + Intronic
984531454 4:180921526-180921548 ATATTGGATTTTTGTGGAAAAGG + Intergenic
987391330 5:17378159-17378181 TTATAGGCTTATTATGAAAATGG + Intergenic
988333372 5:29872993-29873015 CTGTAGAGTTTTTCTGGAAAAGG - Intergenic
989128827 5:38083800-38083822 GTGTAGGCATTTTGAGGAAATGG + Intergenic
989853805 5:46252478-46252500 CTAGAGGCCTATGGTGGAAAAGG - Intergenic
989858112 5:46325910-46325932 TTGTCTGCTTTTTGTGGAAAAGG - Intergenic
989861454 5:46381916-46381938 TTAGAGGCCTTTGGTGGAAAAGG + Intergenic
989943221 5:50180381-50180403 TTTGAGGCTTATTGTGGAAAAGG - Intergenic
989943550 5:50186691-50186713 CTTTGAGCTTATTGTGGAAAAGG - Intergenic
989945193 5:50217148-50217170 TTTTAGGCCTTTTGAGGAAAAGG - Intergenic
990586611 5:57217704-57217726 CAATATGCTTTTTCTGAAAATGG - Intronic
990962528 5:61409732-61409754 TTATTAGCTTTTTGTGGAGAGGG + Intronic
991990524 5:72334286-72334308 CTATGGTCTTTTTTTGGCAACGG - Intronic
993016830 5:82544208-82544230 CTCTAGGCCTTTGATGGAAAAGG - Intergenic
994009677 5:94886131-94886153 CTATAGGCTTTTTGTGGAAAGGG + Intronic
995851422 5:116550047-116550069 CTTTAGGATTTGAGTGGAAAGGG + Intronic
999275712 5:150328763-150328785 CTCTCTGCTGTTTGTGGAAAAGG - Intronic
1000113098 5:158127822-158127844 TAGTTGGCTTTTTGTGGAAATGG + Intergenic
1001479522 5:172078348-172078370 CTTTTGGCTTTTTGAGGACAGGG - Intronic
1001924172 5:175624299-175624321 ACAGAGGCTTTTTGTGGGAACGG - Intergenic
1002777502 6:341520-341542 CTCTGGGCTTTTCTTGGAAAAGG + Intronic
1005019419 6:21403560-21403582 CTAGAGGCATTTAGGGGAAAAGG + Intergenic
1005686447 6:28257704-28257726 CTATTGGCCTTTTGCAGAAAAGG + Intergenic
1006527479 6:34619523-34619545 CTATTTACTTTTTGTAGAAATGG + Intronic
1008354021 6:50530132-50530154 CAATAGGTTTTTTGGGGAACAGG - Intergenic
1009089664 6:58893035-58893057 CTAGAGGCCTTCTTTGGAAATGG + Intergenic
1009118116 6:59288992-59289014 CTAGAGGCCTTCTTTGGAAATGG + Intergenic
1009133736 6:59506315-59506337 CTAGAGGCCTTCTTTGGAAATGG + Intergenic
1009145401 6:59668123-59668145 CTAGAGGCCTTCTTTGGAAACGG + Intergenic
1009155301 6:59805677-59805699 CTAGAGGCTTTGGTTGGAAACGG + Intergenic
1009744639 6:67797178-67797200 CCATAGGTTTTTGGTGGAACAGG - Intergenic
1010673791 6:78718114-78718136 TTATAGGCTTTTGGTGGACAAGG + Intergenic
1011840052 6:91486167-91486189 CTAGAGGCCTCTTGTGGACATGG + Intergenic
1012398030 6:98822318-98822340 CTCCAAGCTTTTTTTGGAAAAGG + Intergenic
1012568250 6:100687883-100687905 ATACAGACTTTTTGTAGAAATGG + Intronic
1013857393 6:114590806-114590828 CAAGAGGATTTTTGTGGGAAAGG - Intergenic
1015453903 6:133403115-133403137 GTTTATGCATTTTGTGGAAAAGG + Intronic
1017162075 6:151374523-151374545 ATAAATGCTCTTTGTGGAAAAGG - Intronic
1018117423 6:160600916-160600938 CTAGAGGCTTTTTTTGAACAAGG - Exonic
1018508088 6:164493140-164493162 ATATATGTTTTATGTGGAAAGGG + Intergenic
1022365371 7:29709445-29709467 CTATAGGCTTGTATTGTAAAGGG - Intergenic
1022747098 7:33183615-33183637 CTCTAGGCTCTTTCTGGGAAGGG - Intronic
1024351371 7:48368323-48368345 CCATAGGTTTTTTGGGGAACAGG + Intronic
1024483847 7:49894090-49894112 TTCTAGGCTTTTTCTGGAAGGGG + Intronic
1025312907 7:57973282-57973304 TTTGAGGCTTTTGGTGGAAAAGG - Intergenic
1025312999 7:57975158-57975180 TTTGAGGCTTATTGTGGAAAAGG - Intergenic
1025315516 7:58021324-58021346 TTCTAGGCCTTTTGTAGAAAAGG + Intergenic
1025472920 7:60879837-60879859 TTTTAGGCTTGTAGTGGAAAAGG - Intergenic
1025499236 7:61263797-61263819 TTTTAGGCTTGTAGTGGAAAAGG + Intergenic
1025499781 7:61272330-61272352 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1025499835 7:61273353-61273375 TTTGAGGCCTTTTGTGGAAAAGG + Intergenic
1025499943 7:61275684-61275706 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1025514084 7:61610029-61610051 TTTTAGGCTTTCAGTGGAAAAGG + Intergenic
1025514634 7:61618539-61618561 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1025514688 7:61619562-61619584 TTTGAGGCCTTTTGTGGAAAAGG + Intergenic
1025514797 7:61621894-61621916 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1025538980 7:62047379-62047401 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1025539035 7:62048402-62048424 TTTGAGGCCTTTTGTGGAAAAGG + Intergenic
1025539142 7:62050734-62050756 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1026416613 7:70188154-70188176 CTAAATGCTTTGTTTGGAAAGGG + Intronic
1028550121 7:92051206-92051228 CTCTAGGCTTTTTAGGGCAAAGG - Intronic
1031246474 7:119319490-119319512 TTATAGCCTATTTGTGGGAAGGG + Intergenic
1031947540 7:127857717-127857739 CTAAAGGCTTTTATTGGGAAAGG + Intronic
1032213217 7:129934886-129934908 ATATATACTTTTTGTAGAAATGG - Intronic
1032681134 7:134184698-134184720 CAATAAGCCTTTTATGGAAAAGG - Intronic
1036445618 8:8819702-8819724 CAAAAGGCTCTTTGGGGAAAAGG - Intronic
1036736355 8:11320998-11321020 CTATTTGCCCTTTGTGGAAACGG + Intronic
1037054051 8:14414723-14414745 CTTAAGGCTCTTTTTGGAAATGG + Intronic
1038871040 8:31493208-31493230 CTGTAGGCTTTTAGTAAAAATGG - Intergenic
1039219693 8:35315858-35315880 CTGTGGGCTTTTTATGGAAGAGG + Intronic
1040141173 8:43915922-43915944 CTTTAGGTCTTTTGTAGAAAAGG + Intergenic
1041212546 8:55567331-55567353 CAATAGGTTTTTTGGGGAACAGG - Intergenic
1041885176 8:62800176-62800198 CAATAGGTTTTTTGGGGAACGGG - Intronic
1042314995 8:67416778-67416800 TAATAGGCTATTAGTGGAAACGG - Intergenic
1042794235 8:72643142-72643164 GTTTTGGCTTTGTGTGGAAAGGG - Intronic
1043130643 8:76456562-76456584 ATATCGTCTTTGTGTGGAAACGG + Intergenic
1045553577 8:103194177-103194199 TAATAGGCTTTAGGTGGAAAAGG - Intronic
1047502778 8:125454736-125454758 CTCTAGGATTTTTCTGGGAAAGG + Intergenic
1048853395 8:138665356-138665378 CCACAGGCTTTTTCTGTAAAGGG + Intronic
1052283893 9:26762725-26762747 CTATAGACTTTCTCTGTAAACGG - Intergenic
1053715331 9:40883120-40883142 CTTGAGCCTTATTGTGGAAAAGG + Intergenic
1053938008 9:43188889-43188911 TTAGAGGCTTATGGTGGAAAAGG + Intergenic
1053939272 9:43213688-43213710 CTTGAGGCTTATGGTGGAAAAGG + Intergenic
1054077223 9:60547643-60547665 CTTGAGCCTTATTGTGGAAAAGG - Intergenic
1054935592 9:70684244-70684266 CCATAGGGTTTCTGAGGAAAGGG + Intronic
1055302857 9:74900294-74900316 CCATAGGCTTTTTGGGGAACAGG + Intergenic
1056182246 9:84096641-84096663 CTTGAGGCTTTTTGTGGCATCGG + Intergenic
1057080542 9:92171586-92171608 ACATAGGCTTTTTGTAGTAAGGG - Intergenic
1059710816 9:116866132-116866154 CTATAAGCTTTTAAAGGAAAAGG + Intronic
1203420275 Un_KI270372v1:61-83 CTTGAGGCCTATTGTGGAAAAGG - Intergenic
1203420167 Un_KI270374v1:731-753 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1203420518 Un_KI270375v1:1304-1326 TTTGAGGCCTTTTGTGGAAAAGG - Intergenic
1203420572 Un_KI270375v1:2327-2349 CTTGAGGCCTATTGTGGAAAAGG - Intergenic
1203379764 Un_KI270435v1:22877-22899 TTTTAGGCCTATTGTGGAAAAGG + Intergenic
1203381136 Un_KI270435v1:44718-44740 TTAGAGGCCTATTGTGGAAAAGG + Intergenic
1203384949 Un_KI270438v1:22574-22596 TTTGAGGCTTTTTGTGGAAAAGG + Intergenic
1203356069 Un_KI270442v1:146607-146629 TTAAAGGCTTATGGTGGAAAAGG - Intergenic
1203356287 Un_KI270442v1:150696-150718 CTTGAGGCTTATTGTGGAAAAGG - Intergenic
1203356349 Un_KI270442v1:151889-151911 CTTGAGGCTTATGGTGGAAAAGG - Intergenic
1203357621 Un_KI270442v1:174374-174396 TTTTAGGCTTATTGTTGAAAAGG + Intergenic
1203372728 Un_KI270442v1:324879-324901 CTAGAGGCCTATTGTGGAAAAGG + Intergenic
1203373136 Un_KI270442v1:332193-332215 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1203373179 Un_KI270442v1:332873-332895 GTTGAGGCCTTTTGTGGAAAAGG + Intergenic
1203374586 Un_KI270442v1:355697-355719 TTTTAGGCCTTTAGTGGAAAAGG + Intergenic
1203375025 Un_KI270442v1:363714-363736 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1203375136 Un_KI270442v1:365935-365957 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1203393117 Un_KI270510v1:1344-1366 TTGTAGGCCTATTGTGGAAAAGG + Intergenic
1203393355 Un_KI270518v1:1080-1102 TTGTAGGCCTATTGTGGAAAAGG + Intergenic
1203393404 Un_KI270518v1:1933-1955 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1203400837 Un_KI270519v1:94852-94874 CTTTAGGCCTATGGTGGAAAAGG + Intergenic
1203401355 Un_KI270519v1:103275-103297 TTAAAGGCCTATTGTGGAAAAGG + Intergenic
1203411817 Un_KI270579v1:18967-18989 TTTGAGGCTTTTTGTGGAAAAGG - Intergenic
1203412013 Un_KI270579v1:23395-23417 TTTGAGGCTTATTGTGGAAAAGG - Intergenic
1203686324 Un_KI270757v1:65839-65861 TTTGAGGCTTATTGTGGAAAAGG - Intergenic
1186334997 X:8576900-8576922 TGATAGGCCTTTTCTGGAAAGGG + Intronic
1186567539 X:10679638-10679660 CAACAAACTTTTTGTGGAAAGGG - Intronic
1186695067 X:12021762-12021784 CTATATGCTTGATGTGAAAACGG - Intergenic
1188551480 X:31369310-31369332 CTATAGGCGCATTGTGGAAAAGG + Intronic
1188798009 X:34490324-34490346 CTATAGGCTCTTTGGGCAAGAGG - Intergenic
1189133538 X:38525585-38525607 CAATAGGCTTTTGGGGGAACAGG + Intronic
1191100846 X:56726538-56726560 CTATAGGTTTTTTGGGGAACAGG - Intergenic
1191266076 X:58395255-58395277 CTGGAGGCCTTTTGTGTAAAAGG + Intergenic
1191274153 X:58517863-58517885 TTTGAGGCTTATTGTGGAAAAGG + Intergenic
1191567886 X:62562677-62562699 TTTGAGGCTTATTGTGGAAAAGG + Intergenic
1191568554 X:62574408-62574430 TTACATGCTTATTGTGGAAAAGG + Intergenic
1191568866 X:62580188-62580210 TTTTAGGCCTCTTGTGGAAAAGG + Intergenic
1191569155 X:62586004-62586026 TTAGAGGCCTATTGTGGAAAAGG + Intergenic
1191572371 X:62644620-62644642 CTTGAGGCCTATTGTGGAAAAGG + Intergenic
1192765297 X:74133709-74133731 CTCTATGCTTCTTCTGGAAATGG + Intergenic
1193761741 X:85475632-85475654 CTATAGCCATTTTGAGGAAAGGG - Intergenic
1193989722 X:88291553-88291575 CCATAGGGTTTTTGGGGAACAGG - Intergenic
1194896789 X:99452137-99452159 CACTTGGCTCTTTGTGGAAAGGG - Intergenic
1196058743 X:111385226-111385248 ATATGGGCTTTTTGTGGTCAGGG - Intronic
1197300921 X:124779613-124779635 ATATAGGATCTTTGTGCAAATGG + Intronic
1199566373 X:149219714-149219736 CTATGGGCTTTTTGCTGAGAGGG - Intergenic
1199690409 X:150305191-150305213 TTAAAAGTTTTTTGTGGAAATGG - Intergenic
1199709102 X:150455810-150455832 CTATAGGCTTTGTAGGCAAATGG - Intronic
1200959775 Y:8986011-8986033 CTATGGACTCTTTGTGGGAAGGG + Intergenic
1201064398 Y:10080069-10080091 TTTTAGGCCTATTGTGGAAAAGG + Intergenic
1201064446 Y:10080949-10080971 TTTTAGGCCTATTGTGGAAAAGG - Intergenic
1201064710 Y:10085970-10085992 TTTCAGGCTTCTTGTGGAAAAGG - Intergenic
1201081152 Y:10248995-10249017 CTTGAGGCCTGTTGTGGAAAAGG - Intergenic
1201081632 Y:10257678-10257700 CTGGAGGCCTGTTGTGGAAAAGG - Intergenic
1201081956 Y:10263467-10263489 CTTGAGGCCTGTTGTGGAAAAGG - Intergenic
1201082182 Y:10317405-10317427 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201082523 Y:10323535-10323557 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201082864 Y:10329663-10329685 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201083186 Y:10335452-10335474 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201083509 Y:10341238-10341260 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201083831 Y:10347028-10347050 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201084153 Y:10352817-10352839 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201084476 Y:10358603-10358625 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201084799 Y:10364389-10364411 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201085098 Y:10369842-10369864 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201085427 Y:10375802-10375824 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201085749 Y:10381588-10381610 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201086070 Y:10387373-10387395 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201086391 Y:10393163-10393185 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201086714 Y:10398954-10398976 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201087041 Y:10404745-10404767 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201087362 Y:10410530-10410552 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201087683 Y:10416313-10416335 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201088004 Y:10422101-10422123 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201088329 Y:10427893-10427915 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201088660 Y:10433854-10433876 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201088961 Y:10439303-10439325 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201089282 Y:10445088-10445110 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201089605 Y:10450877-10450899 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201089928 Y:10456659-10456681 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201090230 Y:10462112-10462134 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201090552 Y:10467899-10467921 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201090877 Y:10473684-10473706 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201091199 Y:10479472-10479494 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201091524 Y:10485265-10485287 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201091849 Y:10491052-10491074 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201092171 Y:10496834-10496856 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201092510 Y:10502962-10502984 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201092833 Y:10508748-10508770 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201093093 Y:10513352-10513374 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201093415 Y:10519139-10519161 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201093738 Y:10524923-10524945 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201093928 Y:10528327-10528349 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201094259 Y:10534283-10534305 CTTGAGGCCTGTTGTGGAAAAGG + Intergenic
1201094599 Y:10540408-10540430 CTGGAGGCCTGTTGTGGAAAAGG + Intergenic
1201095126 Y:10599856-10599878 CTTGAGGCCTGTTGTGGAAAAGG - Intergenic
1201095451 Y:10605809-10605831 CTTGAGGCCTGTTGTGGAAAAGG - Intergenic
1201095782 Y:10611771-10611793 CTTGAGGCCTGTTGTGGAAAAGG - Intergenic
1201096199 Y:10619255-10619277 CTTGAGGCCTGTTGTGGAAAAGG - Intergenic
1201428508 Y:13881363-13881385 ATATAGGCTTTTTCCAGAAAGGG - Intergenic