ID: 994012197

View in Genome Browser
Species Human (GRCh38)
Location 5:94918532-94918554
Sequence CTTGGTAGTGAAGGGATCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994012197_994012203 23 Left 994012197 5:94918532-94918554 CCAAAGATCCCTTCACTACCAAG 0: 1
1: 0
2: 0
3: 6
4: 133
Right 994012203 5:94918578-94918600 TAAGAAAGATATAGCTGAACAGG 0: 1
1: 0
2: 0
3: 13
4: 214
994012197_994012201 -2 Left 994012197 5:94918532-94918554 CCAAAGATCCCTTCACTACCAAG 0: 1
1: 0
2: 0
3: 6
4: 133
Right 994012201 5:94918553-94918575 AGACCAAGAGTAGCAAGAGATGG 0: 1
1: 0
2: 2
3: 29
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994012197 Original CRISPR CTTGGTAGTGAAGGGATCTT TGG (reversed) Intronic
902602075 1:17546868-17546890 CTTGGTAGTGCATGGCTCGTGGG + Intronic
903508567 1:23856070-23856092 CCTAGTAGTCAAGGGGTCTTAGG + Intronic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
910570054 1:88689999-88690021 CTTGGTAGTCAAGAAATATTTGG - Intronic
916289657 1:163150884-163150906 TGTGGTAGAGAAGGGATATTTGG + Intronic
916550690 1:165847178-165847200 CTTCCTAGTGAAATGATCTTGGG + Intronic
917753181 1:178073218-178073240 TGTGGTAGTGAATGGATCTCAGG - Intergenic
921794198 1:219324003-219324025 CTGGGTAGTGAAGAGAGCATCGG - Intergenic
923339101 1:232992751-232992773 CTGGGAAGTGAATGGATCATGGG + Intronic
923585448 1:235265764-235265786 CTTAGTAGTGAGGTGACCTTGGG + Intronic
924443842 1:244109961-244109983 CTTAGCAGTCAAGGGATATTGGG - Intergenic
924577487 1:245293514-245293536 CCTGGTAGTGAAGAGATTCTTGG + Intronic
1062957255 10:1548439-1548461 CATGTCAGTGAAGGGGTCTTTGG - Intronic
1065126540 10:22579527-22579549 CTTGGAGGGGAGGGGATCTTTGG + Intronic
1065259273 10:23907990-23908012 CTTGGTAGTGAAGCCATATTGGG + Intronic
1066990781 10:42511313-42511335 CTTGGACTTGAAGGGATTTTCGG - Intergenic
1069140831 10:64823033-64823055 CTTGGTAATGAACTGATCTGTGG + Intergenic
1072633779 10:97164589-97164611 CAGGGTAGTGCAGGGGTCTTAGG - Intronic
1073573135 10:104597737-104597759 CTTGGCTCTGAATGGATCTTGGG - Intergenic
1073741017 10:106407030-106407052 TTTGCTAGTGGAGTGATCTTAGG + Intergenic
1075839541 10:125487996-125488018 GTTGGTAGTAAAGGGAACTTTGG + Intergenic
1076472702 10:130729871-130729893 GTTGGTGGTGAAGGTAACTTAGG - Intergenic
1080112123 11:28580216-28580238 CTTCATTGTGAAGGGCTCTTGGG + Intergenic
1080783684 11:35454740-35454762 CTAGGCAGTGAAAAGATCTTGGG + Intronic
1087710022 11:101537581-101537603 CTTCTTCATGAAGGGATCTTGGG + Intronic
1089011405 11:115135109-115135131 CTTTGCAGTTAAGGGAGCTTCGG - Intergenic
1089094396 11:115906694-115906716 CCTGGGAAAGAAGGGATCTTTGG - Intergenic
1089975363 11:122727464-122727486 TTTAGAAGTGAAGGCATCTTGGG - Intronic
1090462077 11:126900260-126900282 ATTGGTGGTGAAGGCGTCTTTGG - Intronic
1091013240 11:132025353-132025375 CCTGGGCTTGAAGGGATCTTTGG + Intronic
1095076037 12:37927098-37927120 TTTGCGAGTGAAGGGATATTTGG - Intergenic
1095365071 12:41393771-41393793 CATGGCAGTGAAGTGGTCTTGGG - Intronic
1096086467 12:48868433-48868455 CCTGGAAGTGAATGGAGCTTAGG - Intergenic
1097726565 12:63081676-63081698 CTTGGTGGTGACTGGATCTAGGG + Intergenic
1106629161 13:31452479-31452501 CTTAGAACTGAAGGGATCCTAGG + Intergenic
1106981820 13:35294425-35294447 CTCAGTAGTGAAAGGATTTTTGG + Intronic
1108276492 13:48815597-48815619 CATGGTAGGGAAGGGATACTGGG + Intergenic
1110215256 13:73018093-73018115 CTTGCTATTGAAGTGAGCTTGGG - Intergenic
1111739447 13:92184548-92184570 CTAGGTAGTGAAGAGATGATTGG - Intronic
1117100420 14:52340493-52340515 CTTTGTAGTGAAGGCTGCTTTGG - Intergenic
1117656851 14:57964217-57964239 CTAGCTAGTGAAGGGGTCCTGGG + Intronic
1119499613 14:75113105-75113127 TTGGGGAGTGAAGGGCTCTTGGG + Intronic
1123722913 15:23075509-23075531 CTTTGTAGTGAAAGGGTATTGGG + Intergenic
1130145486 15:81270928-81270950 CCTGTTAGTGACGAGATCTTGGG - Intronic
1132002892 15:98197609-98197631 CAAGGAAGTGAAAGGATCTTGGG - Intergenic
1132394566 15:101463328-101463350 CTTGGTAGAGCAGTGATATTCGG - Intronic
1133475781 16:6120488-6120510 CTTGCTTGTCATGGGATCTTGGG + Intronic
1133565271 16:6987360-6987382 CATGGTAGTGATGAGATTTTAGG - Intronic
1134839649 16:17391631-17391653 CCTGGGAGTAAAGGGATGTTGGG - Intronic
1135976708 16:27113273-27113295 GTTGGTGGTGATGGGAGCTTGGG - Intergenic
1140750186 16:78016428-78016450 CCTGGTGGTGAAGGGATATGGGG - Intergenic
1140999509 16:80295314-80295336 TTTTGTAGTGAAGGAATCTCAGG - Intergenic
1143157484 17:4847497-4847519 CCTGGGCCTGAAGGGATCTTAGG - Intronic
1143309630 17:5977728-5977750 CTGTGTAGTGAAGGGTGCTTAGG + Intronic
1144671165 17:17133406-17133428 CATGGTTGAGATGGGATCTTTGG + Intronic
1153251712 18:3129369-3129391 CTGGGTAGTGAAGGTTTGTTAGG + Exonic
1155705848 18:28811483-28811505 CTTGGGAGGGAATGAATCTTGGG + Intergenic
1156898383 18:42272697-42272719 CTTGGTCCTGAAGGGAACTCTGG - Intergenic
1158713694 18:59859550-59859572 TTTTTTAGAGAAGGGATCTTGGG - Intergenic
1159963929 18:74577966-74577988 ATGGGTAGTGAAGGCATCTGAGG + Intronic
1164763096 19:30742985-30743007 CTGGGTAGTGAAGGTCTTTTGGG + Intergenic
1166977670 19:46614232-46614254 CTGGGAAGTGAGGGGATCCTTGG - Intergenic
928833618 2:35518125-35518147 CTAGGAAGAGAAGGGATCCTGGG - Intergenic
932162257 2:69471770-69471792 TGTGGGAATGAAGGGATCTTTGG - Exonic
936889872 2:117356646-117356668 CTTTGTTTTGAAGGGATCATCGG + Intergenic
936964333 2:118112601-118112623 ATTGGGAGTGAGGGGATCTGGGG + Intergenic
939771023 2:146318521-146318543 CCTGGTAGTGCATGGATTTTTGG - Intergenic
940890564 2:159031419-159031441 CTTGCAAGTGAATGGGTCTTAGG + Intronic
943562647 2:189482382-189482404 TTAGGCAGTGAAGGGATTTTTGG + Intergenic
944452498 2:199857226-199857248 CGTGGTTTTGAAGGGACCTTAGG - Intergenic
944532165 2:200677935-200677957 CTTGCTAATTGAGGGATCTTGGG - Intergenic
944532177 2:200678004-200678026 CTTGTTAATTGAGGGATCTTTGG - Intergenic
945060784 2:205906986-205907008 CTTGGTAGAGAAGGGTCCTTGGG - Intergenic
945402509 2:209402869-209402891 CATGGAAGTAAAAGGATCTTAGG - Intergenic
945686360 2:212975276-212975298 ATTGGAAGTGATGGGATCTAAGG - Intergenic
946988798 2:225303969-225303991 CATGATAGTGAATGGATCTAAGG + Intergenic
948536162 2:238649328-238649350 CTTAGTGGTGAAGGGATGTGTGG - Intergenic
1169638867 20:7725671-7725693 GTTGGTAAAGAAGAGATCTTGGG + Intergenic
1169745105 20:8935553-8935575 CTTGGTAGTGAAGGGAAATAGGG - Intronic
1171390902 20:24801112-24801134 CTTGCTAATGAAGTGAACTTTGG - Intergenic
1173059304 20:39646386-39646408 CTTTGTAGAGAATGGATCTGGGG - Intergenic
1173468026 20:43299846-43299868 CTTGTTAGCCATGGGATCTTGGG - Intergenic
1178993334 21:37374051-37374073 TTTAGTAGTGAAGGGATTTTGGG + Intronic
1179159666 21:38883850-38883872 CTAGGTAGATAAGGGAACTTTGG - Intergenic
1179188492 21:39103735-39103757 CCTGGAATGGAAGGGATCTTTGG - Intergenic
1181302148 22:21888361-21888383 CATGGTAGAGTAGGGATCTATGG + Intergenic
958987020 3:100792728-100792750 CTTAGTTGTGAAAGGTTCTTGGG + Exonic
967309653 3:188093926-188093948 CTGGGTTGTGTATGGATCTTGGG + Intergenic
969249874 4:5960259-5960281 GTTGGTCGTGAAGGGATCACAGG - Intronic
976353669 4:84089327-84089349 CTTGGTAGTGAAGAGACAATAGG + Intergenic
978160352 4:105539515-105539537 CATGGTAGAGAAGGACTCTTTGG + Intergenic
978594228 4:110359338-110359360 CTACTTAGTGAAGGGTTCTTTGG + Intergenic
980952229 4:139392490-139392512 GTAGGAAGTGAAGGGATTTTTGG + Intronic
981456760 4:144961915-144961937 CTAGGAAGAGAAGGGAACTTGGG + Intergenic
981538707 4:145826193-145826215 CTTCATAGTTAAGGGACCTTTGG + Intronic
982503476 4:156189218-156189240 CATGATAGTGAGGGGATTTTTGG + Intergenic
982997070 4:162362669-162362691 CTTGGTAGTTTCGCGATCTTCGG - Intergenic
983563508 4:169125436-169125458 CCAGGTAGTGATTGGATCTTAGG + Intronic
986302245 5:6486930-6486952 CTTGGTATTGTTGGCATCTTGGG - Intronic
988365344 5:30290885-30290907 GTTATTAGTGAAGGCATCTTGGG + Intergenic
988438630 5:31206878-31206900 TTTGGTAGTGAAGGGAGGTATGG - Intronic
990141715 5:52712213-52712235 TTTGGCAGTGGAGGGAGCTTTGG - Intergenic
990781433 5:59369066-59369088 ATTGGAAGCTAAGGGATCTTGGG - Intronic
991355053 5:65760140-65760162 CTTGGTGATGAAGGGATAGTGGG - Intronic
992969333 5:82039931-82039953 CATGTTAGTGAAGCCATCTTAGG - Intronic
994012197 5:94918532-94918554 CTTGGTAGTGAAGGGATCTTTGG - Intronic
998060964 5:139118527-139118549 CTTGATACTTAGGGGATCTTGGG - Intronic
998607911 5:143654460-143654482 CTTTTTATTGAATGGATCTTTGG - Intergenic
999471476 5:151858653-151858675 CTGGGTAGGGGAGGGAGCTTAGG - Intronic
1001109058 5:168880390-168880412 CATGGGAGTGGAGGGATCTGGGG - Intronic
1001217585 5:169870132-169870154 CTTGGATGTGAAGGGCTCTAAGG - Intronic
1001376320 5:171262381-171262403 CTTTGTAGAAAAGGGAGCTTTGG - Intronic
1001539304 5:172526241-172526263 CCTGGTAGTGAAGGAATCAGGGG + Intergenic
1007828632 6:44621077-44621099 CTTTGTTATGAAGGAATCTTTGG + Intergenic
1008351852 6:50500311-50500333 GTTGGTTGTGTAGGGCTCTTCGG - Intergenic
1008472977 6:51904537-51904559 CTTTGTAATGAAGGGTTCTTTGG - Intronic
1012426179 6:99117165-99117187 CTTGGTAGGCCAGGGATATTTGG + Intergenic
1013417852 6:109940482-109940504 CATGGTAGTGAATGGGTCTATGG + Intergenic
1013802984 6:113968922-113968944 GTTGGTAGTGATGGGCTCTGAGG - Intronic
1021269646 7:18570091-18570113 CCTGGTAATGAAGTCATCTTCGG - Intronic
1021911883 7:25393831-25393853 CTTGTTATTGAAGGTATCTCTGG + Intergenic
1025011898 7:55404193-55404215 CTTGGCAGGGAAGAGAACTTAGG - Intronic
1028428436 7:90718054-90718076 GTTGGTAGTGAGGGCATTTTTGG + Intronic
1033157768 7:138971414-138971436 CTTGGAAGGGATGGGATCTAGGG - Intronic
1035834064 8:2729092-2729114 CTTGGTGGAGAAGGAATCTGTGG + Intergenic
1036979828 8:13457781-13457803 CTTGGTGGGGCAGGGATCATCGG - Intronic
1039702786 8:39978970-39978992 CTGGGATGTGAAGGGACCTTTGG - Intronic
1046914664 8:119667165-119667187 CTTGGTATTTAAGGCATCCTGGG - Intronic
1047506704 8:125486061-125486083 CTCGGAAGTGATGGGATCTGAGG - Intergenic
1049264415 8:141659792-141659814 CTTAGCAGTGAAGGGCTCCTTGG - Intergenic
1050394940 9:5185838-5185860 CGGGGTAGTGAGGGGATTTTTGG - Intergenic
1050571592 9:6945220-6945242 CTTGTTAGTCAATTGATCTTAGG + Intronic
1056177950 9:84053783-84053805 CTTGGTAGTGAAGGGAAGGAGGG + Intergenic
1189635565 X:43004842-43004864 CTTGGTAGATAAGGGAGCATAGG + Intergenic
1190852068 X:54254939-54254961 CTTGCTAGTTGAGTGATCTTAGG + Intronic
1196172859 X:112609290-112609312 CTTGGTAGTGTAGAGATAATGGG + Intergenic
1197679220 X:129364312-129364334 CTTGGTAGTAGAGGGAGTTTGGG - Intergenic
1198725901 X:139676578-139676600 CTTGGTAGTTATGTGACCTTGGG + Intronic
1199360357 X:146910538-146910560 GTTGGAAGTGATTGGATCTTGGG - Intergenic
1199810849 X:151347040-151347062 CTTTGTAGGGAAGGGGGCTTTGG + Intergenic