ID: 994013338

View in Genome Browser
Species Human (GRCh38)
Location 5:94935096-94935118
Sequence GTTTCTTGTACACACAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994013335_994013338 -5 Left 994013335 5:94935078-94935100 CCCTCCATGGAGGTTTTGGTTTC 0: 1
1: 1
2: 2
3: 24
4: 182
Right 994013338 5:94935096-94935118 GTTTCTTGTACACACAATGCTGG 0: 1
1: 0
2: 0
3: 10
4: 143
994013331_994013338 15 Left 994013331 5:94935058-94935080 CCATGCAACTCATCAGCATGCCC 0: 1
1: 0
2: 0
3: 14
4: 122
Right 994013338 5:94935096-94935118 GTTTCTTGTACACACAATGCTGG 0: 1
1: 0
2: 0
3: 10
4: 143
994013337_994013338 -9 Left 994013337 5:94935082-94935104 CCATGGAGGTTTTGGTTTCTTGT 0: 1
1: 0
2: 1
3: 23
4: 371
Right 994013338 5:94935096-94935118 GTTTCTTGTACACACAATGCTGG 0: 1
1: 0
2: 0
3: 10
4: 143
994013336_994013338 -6 Left 994013336 5:94935079-94935101 CCTCCATGGAGGTTTTGGTTTCT 0: 1
1: 0
2: 2
3: 35
4: 196
Right 994013338 5:94935096-94935118 GTTTCTTGTACACACAATGCTGG 0: 1
1: 0
2: 0
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994013338 Original CRISPR GTTTCTTGTACACACAATGC TGG Intronic
905053130 1:35069820-35069842 GTTTCTTCAATAAACAATGCTGG - Intronic
907096907 1:51790433-51790455 GTTTCTCTTCCACACAATGCTGG + Intronic
908018877 1:59879024-59879046 GTTTGTTGGACACACAGTGGAGG - Intergenic
922660500 1:227425636-227425658 TCTTCTTGAACACACAATCCAGG + Intergenic
922812173 1:228423190-228423212 ATTGCTTCTACACACAATACAGG + Intergenic
924083879 1:240428030-240428052 GTTTCTTATACAGGAAATGCAGG + Intronic
1065046713 10:21752476-21752498 ATTTCCTGTCCACAGAATGCAGG - Intergenic
1066665998 10:37783053-37783075 GTTTCTAGCACAGTCAATGCTGG - Intronic
1066710283 10:38226319-38226341 GTTTCTTAGAGACACATTGCTGG + Intergenic
1068396630 10:56470305-56470327 GTTTCTTGATCACTCAAGGCTGG - Intergenic
1071211989 10:83352912-83352934 ATTTCTTGTACACAGTATGCAGG - Intergenic
1072397081 10:95055386-95055408 GTTTCTTCAACAAACAGTGCTGG + Intronic
1072628330 10:97128579-97128601 GGATCCTGCACACACAATGCAGG - Intronic
1072745122 10:97934428-97934450 GTTTCTTGGCTACACAAGGCTGG + Intronic
1073646443 10:105309243-105309265 CTTTCTAGTCCACACAATGAAGG - Intergenic
1074568446 10:114602603-114602625 GTGTCTGATACACACACTGCAGG + Intronic
1075872954 10:125783802-125783824 TTTTCTTGTCCCCAAAATGCAGG + Intergenic
1079356082 11:19731214-19731236 ATTTCCTGTACATAAAATGCTGG + Intronic
1081105342 11:39060382-39060404 GTTTCATGTACCCACAATTAAGG + Intergenic
1081967589 11:47178932-47178954 ATCTCTTGTAGGCACAATGCTGG + Exonic
1082132182 11:48504520-48504542 GTTTCTTCAACAAATAATGCTGG + Intergenic
1082244410 11:49905095-49905117 GTTTCTTCAACAAATAATGCTGG - Intergenic
1082244623 11:49906919-49906941 GTTTCTTCAACAAATAATGCTGG - Intergenic
1082565858 11:54676965-54676987 GTTTCTTCAACAAATAATGCTGG + Intergenic
1083512323 11:63221862-63221884 GTCTCTTTAATACACAATGCTGG - Intronic
1084186363 11:67474295-67474317 GTTTCAGGTAAACACAATGCTGG - Intergenic
1091237158 11:134029994-134030016 TTTGCTTGTACAGACACTGCTGG - Intergenic
1092519661 12:9255765-9255787 GCTTCTTGGACACACCATCCAGG + Intergenic
1097110325 12:56653180-56653202 GTTTCATATACATATAATGCAGG + Intergenic
1097134795 12:56843113-56843135 GTTTCTTGTAGACAGACTACTGG + Intergenic
1098557570 12:71837132-71837154 GTTTAATGTACACACAAATCAGG + Intergenic
1099220321 12:79906565-79906587 GCTTATTGTACACAAAGTGCTGG + Intronic
1100369014 12:93948354-93948376 CTTTCTTGTACACAGAATTTGGG - Intergenic
1100619629 12:96258742-96258764 ATTTCTTGCACACACACAGCAGG - Intronic
1103673775 12:122639769-122639791 GTTTCTTTTTCATGCAATGCTGG - Intergenic
1104549230 12:129740888-129740910 ATTTCCTGTACACACTATTCAGG + Intronic
1105350496 13:19610719-19610741 GTTTCTTCAACAAACACTGCTGG - Intergenic
1109620118 13:64892741-64892763 CTTTCTTGAACACACAATTGGGG + Intergenic
1110691612 13:78436405-78436427 GTTTCTTGTACCCACAAGAATGG + Intergenic
1110907079 13:80904493-80904515 ATTTATTGTAAACACAATGAGGG - Intergenic
1117259313 14:54014284-54014306 GTCTTTTCTACATACAATGCTGG - Intergenic
1119421562 14:74510535-74510557 GTTCCTGGCACACACAATGAGGG - Intronic
1119798750 14:77423799-77423821 GTTTCTTGAACACAAAAAGAAGG - Intergenic
1120918831 14:89735473-89735495 GATACTTATACACACAATGTGGG + Intergenic
1121481164 14:94275931-94275953 GTTTATTGGACTCACAATTCTGG - Intronic
1124165941 15:27325670-27325692 GTTTCTTGTTGGCACAGTGCTGG + Intronic
1124199981 15:27670933-27670955 TTTTTGTGGACACACAATGCTGG - Intergenic
1127808714 15:62544497-62544519 CTTCCTTGTACACACAGTGTTGG - Intronic
1127950968 15:63805990-63806012 GCCTCTTGTCCACCCAATGCTGG + Intronic
1130418331 15:83715153-83715175 GTTTCAAGAAAACACAATGCAGG + Intronic
1131048613 15:89332413-89332435 GTTTCTTTTTCAAACAATGATGG - Intronic
1134433997 16:14238114-14238136 GTTTCTGGTTGTCACAATGCGGG + Intronic
1141557123 16:84843571-84843593 GTTTCTTGTTCCCATCATGCAGG - Intronic
1153423962 18:4942479-4942501 GTTTCTTTTTATCACAATGCTGG - Intergenic
1154086988 18:11316037-11316059 GTTTCTTGTATACATATTGTTGG + Intergenic
1155028001 18:21959810-21959832 GTGTTTTCCACACACAATGCTGG - Intergenic
1155975456 18:32124103-32124125 GTTTCTTCCACACACGATTCAGG + Intronic
1158559741 18:58503964-58503986 TTTTCTGGTACACCCAGTGCTGG + Exonic
1159177021 18:64850700-64850722 GTATCTTGTACAAATAAGGCAGG - Intergenic
1159492481 18:69155638-69155660 ATTTATTGTTCACACAATTCTGG + Intergenic
1160695129 19:480181-480203 GTTTCTCCTACACACCAGGCAGG - Intergenic
1163747444 19:19056781-19056803 GATTCTTGGACACACCAGGCTGG + Intronic
1163870712 19:19819302-19819324 ATTTCTTGGAGACACATTGCTGG - Intronic
1163958715 19:20667122-20667144 ATTTCTTGGAGACACATTGCTGG + Intronic
1163993684 19:21022928-21022950 ATTTCTTGGAGACACATTGCTGG + Intronic
1164023252 19:21327809-21327831 ATTTCTTGGAGACACAGTGCTGG - Intronic
1164079927 19:21853239-21853261 ATTTCTTGGACACACATTGCTGG + Intergenic
1164182883 19:22834732-22834754 ATTTCTTGGAGACACATTGCTGG + Intergenic
1164241465 19:23393206-23393228 ATTTCTTGGAGACACATTGCTGG - Intronic
1166018931 19:40007143-40007165 TATTCTTTTACACACATTGCAGG + Intronic
928269851 2:29846188-29846210 GTTTCTTGAACACACCACGCTGG + Intronic
930388445 2:50728926-50728948 GTTTGTTGAACACACTGTGCTGG + Intronic
935394103 2:102587415-102587437 GATTCTTCTACCCACAATGAAGG - Intergenic
935505536 2:103897318-103897340 GTTTTTTGGACATAAAATGCAGG + Intergenic
938782916 2:134601670-134601692 GTGTCTTGAACACACAGTGCCGG - Intronic
942111583 2:172687996-172688018 GCTTCTTGTCCCCACAATTCTGG - Intergenic
944024606 2:195148394-195148416 GTTTCTTGGACGCAAAAGGCTGG - Intergenic
946627011 2:221623814-221623836 GGTTAAAGTACACACAATGCTGG + Intergenic
948561519 2:238856947-238856969 GCTTCTTGGACACACTTTGCTGG - Intronic
1177284142 21:19025461-19025483 GTTTCTTGTGTACACATTGAAGG + Intergenic
1179307846 21:40170975-40170997 CATTCTTGTAAACACTATGCTGG - Intronic
1183771987 22:39934606-39934628 GTTTCTTGAAACCAAAATGCAGG - Intronic
952269263 3:31816364-31816386 GGTTCTTGCACACACACTGTGGG - Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
957791120 3:84942292-84942314 TTTTCTTGTAAACAGAATGTGGG - Intergenic
961209179 3:125112094-125112116 GTTTCTATTACACACAATGGGGG + Intronic
963199471 3:142571521-142571543 GTATCATGTACACCCAAAGCAGG + Intronic
965965320 3:174481962-174481984 GTTGTGTGTACACACAATGTAGG + Intronic
966030849 3:175345941-175345963 GTTTCTTGTAAATACTATTCTGG - Intronic
970158047 4:13161233-13161255 GTTTCTTTTAAACACATGGCCGG - Intergenic
971678423 4:29666289-29666311 TTTTTTTCTACACACTATGCCGG - Intergenic
975756329 4:77575331-77575353 GTTACATGTACACAACATGCAGG + Intronic
976823359 4:89232375-89232397 GTTTCTTATACATAGAATGCTGG - Intergenic
978535839 4:109761516-109761538 GTTTGTTATACACAGAAAGCAGG - Exonic
982769881 4:159387856-159387878 GTTTCTTGTAGACACCATATAGG - Intergenic
985444189 4:190011977-190011999 TTTTCTTAGACACACAGTGCGGG - Intergenic
987328081 5:16830462-16830484 GTTGCTTATACCCACTATGCAGG + Intronic
990853775 5:60239918-60239940 ATTTCTTTTACCTACAATGCTGG + Intronic
991022375 5:61993258-61993280 GTTTCTTGTATACACAGTCTCGG - Intergenic
992447168 5:76844486-76844508 CTTTCTTGAACACACTATTCTGG - Intergenic
993423549 5:87733270-87733292 GTTTCTTTCACTCACAAGGCAGG + Intergenic
993883218 5:93387216-93387238 GTTTTTAGTACACACAATATTGG + Intergenic
994013338 5:94935096-94935118 GTTTCTTGTACACACAATGCTGG + Intronic
995395994 5:111687652-111687674 GTTTATTGTACACAAAACTCGGG - Intronic
996233835 5:121102365-121102387 ATATCTTATACACAAAATGCAGG - Intergenic
996871693 5:128199608-128199630 GTTTCATGTCCTCACTATGCTGG + Intergenic
999331827 5:150678723-150678745 GTTTGTTGTGAACACAGTGCAGG + Exonic
1000967646 5:167678367-167678389 GATTCTTATATACTCAATGCAGG + Intronic
1001914506 5:175548289-175548311 CTTTCTTCTCCACCCAATGCGGG + Intergenic
1003245276 6:4377588-4377610 GTGTCTGGCACACACAATGAAGG + Intergenic
1005251474 6:23951057-23951079 GTTACTTTTACAGTCAATGCAGG - Intergenic
1007387343 6:41528738-41528760 TTTTCTTTCACACACAGTGCAGG - Intergenic
1008077625 6:47162188-47162210 GGATCTTGTATACACATTGCTGG + Intergenic
1008956378 6:57221439-57221461 GTTTCTTGTTCATAGAGTGCTGG - Intronic
1009533547 6:64851860-64851882 GTTTCTTGTACAGACCACCCAGG - Intronic
1010360923 6:74992341-74992363 TTTTCTTGTACACAGAAAGAGGG - Intergenic
1011663224 6:89611901-89611923 GTTTTCTTAACACACAATGCTGG - Intronic
1013146471 6:107399085-107399107 GTTACTATTACATACAATGCTGG - Intronic
1014323476 6:119961961-119961983 GTTTCTTGTACATAAATAGCAGG - Intergenic
1014712518 6:124823797-124823819 GATTCTTGGGCACACAATGTAGG - Exonic
1015483344 6:133740630-133740652 GTTGCTTCTGCACACAAGGCAGG + Intergenic
1016081034 6:139856465-139856487 TTTTCATGTACACACACTCCTGG - Intergenic
1018765371 6:166928816-166928838 GGTTCTGGAACACACAATGTAGG + Intronic
1019576816 7:1741550-1741572 GATTCTTATACTCACAATGGGGG + Intronic
1023514975 7:40992802-40992824 TTTTCTTGTACCCACATTACAGG - Intergenic
1023683047 7:42707635-42707657 GTCTCTGGTCCACTCAATGCTGG + Intergenic
1023860620 7:44215966-44215988 GTTACTTGGACCCAAAATGCAGG + Intergenic
1023867798 7:44247054-44247076 CTTCCTTGTACACAGCATGCAGG + Intronic
1024197821 7:47076758-47076780 GTTTTTTGTACACTCAAAGATGG - Intergenic
1024360422 7:48462249-48462271 TTATCTTGCAAACACAATGCAGG + Intronic
1025767116 7:64465806-64465828 ATTTCTTGTAGACACATTGCTGG + Intergenic
1025778590 7:64579475-64579497 ATTTCTTGGAGACACATTGCTGG + Intergenic
1026162822 7:67884887-67884909 GTTTCTTCTACAAATGATGCTGG + Intergenic
1027987716 7:85315691-85315713 GTTTCTTTTCCACATATTGCTGG - Intergenic
1028186106 7:87786628-87786650 TTTTCTTTTACAAACAATACTGG + Intronic
1030734842 7:113035480-113035502 TTTTGTTGTACACACAATACAGG - Intergenic
1032506431 7:132438071-132438093 GTCTCTGGTACACCCTATGCAGG + Intronic
1036434586 8:8722053-8722075 TTTTCTTGTTCATAAAATGCGGG + Intergenic
1037157877 8:15727982-15728004 ATTTCTTGTATACATAAGGCAGG - Intronic
1037531668 8:19781737-19781759 GTTTTTTCAACAAACAATGCTGG + Intergenic
1041117444 8:54553852-54553874 GTTTTTTGTCCCCACATTGCAGG - Intergenic
1048895631 8:138989900-138989922 GTTTATTGGACACACATGGCTGG + Intergenic
1052845301 9:33330271-33330293 GGTTCTGTTAAACACAATGCAGG + Intronic
1056918408 9:90764159-90764181 GTTCCAGGTAAACACAATGCTGG - Intergenic
1059594495 9:115703813-115703835 GTTTCTTTAACAAATAATGCTGG + Intergenic
1188165998 X:26865088-26865110 CTTTCTTGTTCCCACTATGCAGG - Intergenic
1193326326 X:80182084-80182106 GTTTCAGGTAAAGACAATGCTGG + Intergenic
1193861233 X:86671195-86671217 GTATCATGTATACACAATGAAGG - Intronic
1193903105 X:87207546-87207568 ATTTCTTGTACACACATAGTTGG - Intergenic
1194337261 X:92663552-92663574 GTTTCTTTTTCACAGAATCCAGG - Intergenic
1196347338 X:114679200-114679222 GCTTTTTCTACACACAGTGCTGG + Intronic
1197610604 X:128634167-128634189 GTTTCTTGGCCTCACACTGCAGG - Intergenic
1200645687 Y:5780284-5780306 GTTTCTTTTTCACAGAATCCAGG - Intergenic
1202053073 Y:20801228-20801250 GTTCCTTTGACACACAAAGCAGG + Intergenic