ID: 994015029

View in Genome Browser
Species Human (GRCh38)
Location 5:94955454-94955476
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 979
Summary {0: 1, 1: 7, 2: 117, 3: 407, 4: 447}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994015025_994015029 2 Left 994015025 5:94955429-94955451 CCTGGTAAGGGGGCTAAAGCCAG 0: 1
1: 29
2: 595
3: 617
4: 866
Right 994015029 5:94955454-94955476 TGCCGAGTGGTCTTGCTCAGTGG 0: 1
1: 7
2: 117
3: 407
4: 447
994015023_994015029 4 Left 994015023 5:94955427-94955449 CCCCTGGTAAGGGGGCTAAAGCC 0: 1
1: 23
2: 523
3: 564
4: 415
Right 994015029 5:94955454-94955476 TGCCGAGTGGTCTTGCTCAGTGG 0: 1
1: 7
2: 117
3: 407
4: 447
994015024_994015029 3 Left 994015024 5:94955428-94955450 CCCTGGTAAGGGGGCTAAAGCCA 0: 1
1: 31
2: 592
3: 578
4: 483
Right 994015029 5:94955454-94955476 TGCCGAGTGGTCTTGCTCAGTGG 0: 1
1: 7
2: 117
3: 407
4: 447
994015017_994015029 27 Left 994015017 5:94955404-94955426 CCAGTGAAACAGAACTGTTCACT 0: 6
1: 81
2: 206
3: 443
4: 653
Right 994015029 5:94955454-94955476 TGCCGAGTGGTCTTGCTCAGTGG 0: 1
1: 7
2: 117
3: 407
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900039024 1:441428-441450 AGCCAAGTGGTCTGGCTCGGCGG + Intergenic
900060456 1:676404-676426 AGCCAAGTGGTCTGGCTCGGCGG + Intergenic
901835163 1:11919377-11919399 TGCTGAGTGGCCCTGCTGAGTGG - Intergenic
903566929 1:24274703-24274725 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
904965704 1:34370907-34370929 GGCCGAGGAGTCTTCCTCAGGGG - Intergenic
906586737 1:46984895-46984917 AGCCAAGTGGTCTAGGTCAGTGG + Intergenic
906739960 1:48173173-48173195 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
907015168 1:51005410-51005432 AGCCAAGTGGTCTAGTTCAGTGG + Intergenic
908598287 1:65711495-65711517 AGCCAAGTGGTCTTGCTCAGTGG - Intergenic
908601414 1:65744152-65744174 AGCCAAGTGATCTTGCTCAGTGG - Intergenic
908611415 1:65865331-65865353 AGCCAAGTGGTCTCACTCAGCGG - Intronic
909415661 1:75402883-75402905 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
909536431 1:76741590-76741612 AGACAAGTGGTCTAGCTCAGTGG - Intergenic
910330987 1:86072197-86072219 AGCCAAGTGGTCTAGTTCAGTGG + Intronic
910604835 1:89072062-89072084 AGCCAAGTGGTCTTGCTCAATGG + Intergenic
910635722 1:89405405-89405427 AGCCAAGTTGTCTTGCTCAGCGG - Intergenic
910805744 1:91188591-91188613 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
911270644 1:95797401-95797423 AGCCAAGTAGTCTAGCTCAGGGG + Intergenic
911348054 1:96721288-96721310 TACCAAGTGGTCTCGTTCAGTGG + Intergenic
911632639 1:100200094-100200116 AGCCAAGTGGTCTTGCTCAGTGG + Intronic
911692062 1:100845593-100845615 AGCCAAGTGGTCTAGCTCAGCGG - Intergenic
912276284 1:108262033-108262055 AGCCAAGTGGTCTCGCTCAGAGG + Intergenic
912291944 1:108432325-108432347 AGCCAAGTGGTCTCGCTCAGAGG - Intronic
912511844 1:110195065-110195087 TGCTGAGTCGTCTTGGGCAGGGG + Intronic
912894890 1:113576143-113576165 AGCCAAGTGGTCTTGGTCAGTGG - Intronic
912966231 1:114239765-114239787 AGCCAAGTGGTCTAGCTCAGCGG + Intergenic
913108672 1:115639425-115639447 AGCCAAGTGGTCTAGCTCAGGGG - Intergenic
915269539 1:154743747-154743769 TGCCGGGTGATTTTGCTCAGCGG + Intronic
915649066 1:157294413-157294435 AGCCAAGTGGTCTAGCTCAGCGG + Intergenic
915663607 1:157424450-157424472 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
915771785 1:158432985-158433007 AGCCAAGTGGACTAGCTCAGGGG - Intergenic
916359535 1:163952741-163952763 AGCCAAGTGGTCTAGCTCAGCGG + Intergenic
916406261 1:164500666-164500688 AGCCAAGTGGCCTAGCTCAGTGG + Intergenic
916612812 1:166409854-166409876 AGCCAAGGGGTCTTGCTCAGCGG - Intergenic
916878737 1:168998524-168998546 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
916938531 1:169656452-169656474 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
917019363 1:170569362-170569384 AGCCAAGCGGTCTTGCTCAGTGG + Intergenic
917091719 1:171359723-171359745 AGCCCAGTGGTCTAGCTCAGCGG + Intergenic
917157935 1:172024989-172025011 AGCCAGGTGGTCTAGCTCAGCGG + Intronic
917163158 1:172080577-172080599 AGCCAAGTGGTCTAGGTCAGCGG - Intronic
917357748 1:174144058-174144080 AGCCAAGTGGTCTAGCTCAGCGG + Intergenic
918160009 1:181889563-181889585 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
918163347 1:181920922-181920944 AGCCGAGTGGTCTTGCTCAGTGG + Intergenic
918167256 1:181961878-181961900 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
918195643 1:182218965-182218987 AGCCAAGTGGTCTAGCTCAGCGG + Intergenic
918501509 1:185201203-185201225 AGCCAAGTGGTCTAGCTCCGTGG - Intronic
918612852 1:186512367-186512389 AGCCAAGTGGTCTAGCTCAGCGG - Intergenic
918632102 1:186730553-186730575 AGCCGAGTGGTCTAGCTCAGTGG - Intergenic
918906816 1:190506333-190506355 AGCCAAGTGGTCCAGCTCAGCGG - Intergenic
919146791 1:193645351-193645373 AGCCAAGTGGTCTTGCTCAGCGG - Intergenic
919412956 1:197269281-197269303 TGCCAAGTTGTCTTGTTCAACGG - Intronic
919461681 1:197884471-197884493 AGCCAAGTGGTCTGGCTCAGCGG - Intergenic
919598977 1:199599654-199599676 AGCCAAGTGGTCCAGCTCAGTGG + Intergenic
920985576 1:210885581-210885603 AGCCAAGTGGTCTAGTTCAGTGG + Intronic
921296868 1:213712467-213712489 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
921484873 1:215703765-215703787 AGCCGTGTGGTCTTGCTCAGTGG - Intronic
921738262 1:218653464-218653486 AGCGAGGTGGTCTTGCTCAGTGG + Intergenic
921960653 1:221030246-221030268 TGCCCCGTTGTCCTGCTCAGTGG - Intergenic
922066195 1:222145961-222145983 AACCAAGTGGTCTTGCTCAGTGG + Intergenic
922406235 1:225316304-225316326 ATCCAAGTGGTCTTGCTCAGTGG - Intronic
923061259 1:230476581-230476603 AGCCAAGTGGTCTAGCTTAGCGG - Intergenic
924179994 1:241430902-241430924 AGCCAAGTGGTCTAGCTCAATGG - Intergenic
924253410 1:242158262-242158284 AGCCAAGTGGTCTGGTTCAGCGG - Intronic
924254569 1:242169617-242169639 AGCCAAGTGGTCTGGTTCAGTGG + Intronic
924296005 1:242587136-242587158 AGCCTAGTGGTCTGGCTCCGTGG + Intergenic
924494017 1:244568794-244568816 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
924823124 1:247513460-247513482 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
924829026 1:247573123-247573145 AGCCAAGTGGTCTTGCTCAGTGG - Intronic
1062899124 10:1128832-1128854 TGCTCGGTGGTCCTGCTCAGTGG + Intronic
1062899132 10:1128873-1128895 TGCTCGGTGGTCCTGCTCAGTGG + Intronic
1063106172 10:2994123-2994145 TGCAGAGAGGCCTTGCTAAGCGG + Intergenic
1063337982 10:5234981-5235003 AGCTGAGTGGTCTAGCTCAGTGG + Intergenic
1064280117 10:13943887-13943909 AGCAGAGTGGCCCTGCTCAGTGG + Intronic
1065076016 10:22080240-22080262 AGCCAAGTGGTCTGGCTCAGTGG - Intergenic
1065621594 10:27587507-27587529 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1065907641 10:30272296-30272318 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
1066159646 10:32714588-32714610 AGCTGAGTGGTCTTCCTCAGTGG + Intronic
1067236391 10:44454143-44454165 AGCCAAGTGGTCTGGCTCACTGG - Intergenic
1067329465 10:45301500-45301522 AGCCAAGTGGTCTCGCTCAGTGG - Intergenic
1068086115 10:52375180-52375202 AACCAAGTGCTCTTGCTCAGTGG - Intergenic
1068469970 10:57448431-57448453 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1069120837 10:64567418-64567440 TGCCAAGTGGTCTCGCTCATTGG - Intergenic
1069139933 10:64810387-64810409 AGACAAGTGGTCTTGCTCAGTGG - Intergenic
1069264306 10:66438646-66438668 AGTCAAGTGGTCTAGCTCAGCGG - Intronic
1069348992 10:67502920-67502942 AGCCAAGTGGTGTAGCTCAGCGG - Intronic
1070213155 10:74347606-74347628 AGCCACGTGGTCTTGCTTAGAGG + Intronic
1070234478 10:74609190-74609212 AGCCAAGTGGTCTAGCTCAGCGG - Intronic
1071002034 10:80841702-80841724 AGCCAAGTGGTCTTGCTTAGTGG - Intergenic
1071401798 10:85280336-85280358 AGCCAAGTGGTCTAGCTTAGTGG - Intergenic
1072044866 10:91644333-91644355 AGCCAAGTGGTCTAGCTCAGCGG + Intergenic
1072365373 10:94703687-94703709 AGCCAAGTGGTCTAGCTCACAGG - Intronic
1072394706 10:95026733-95026755 AGCCAAGTGGCCTAGCTCAGTGG - Intergenic
1072854877 10:98936255-98936277 AGCCAAGTGGTCTTGCTCAGTGG - Intronic
1072872284 10:99132927-99132949 AGCCAAGTGGTCTGGCTCAGAGG + Intronic
1072876166 10:99175309-99175331 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
1073060563 10:100731077-100731099 AGCCGAGTGCTCCTGCTCGGGGG + Intergenic
1074015526 10:109530214-109530236 AGCCAAGTGGTCTCACTCAGCGG + Intergenic
1074016776 10:109542522-109542544 AGTCAAGTGGTCTGGCTCAGCGG - Intergenic
1074510610 10:114108608-114108630 TGCCCAGTGCTTTTCCTCAGTGG - Intergenic
1074881668 10:117664578-117664600 GGCAAAGTGGTCTTGCTGAGGGG + Intergenic
1075983931 10:126766998-126767020 AGCTGAGTGGTCTTGTTCAGTGG - Intergenic
1076389783 10:130090601-130090623 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1076965233 11:77337-77359 AGCCAAGTGGTCTGGCTCGGCGG + Intergenic
1077341718 11:2029189-2029211 AGCCGAGTGGGCTGGCTGAGAGG - Intergenic
1077428324 11:2498637-2498659 AGCCAAGTGGTCTCACTCAGTGG - Intronic
1077481786 11:2818433-2818455 TGCCAAGAGGCCTTCCTCAGAGG + Intronic
1077562065 11:3270373-3270395 ACCCAAGTGGTCTAGCTCAGTGG - Intergenic
1077567959 11:3316193-3316215 ACCCAAGTGGTCTAGCTCAGTGG - Intergenic
1077696422 11:4397058-4397080 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1078331497 11:10426041-10426063 AGCCAAGTGGTCTAGCTCAGCGG - Intronic
1078429173 11:11274380-11274402 AGCCAAGTGGTCTGGATCAGTGG + Intronic
1078686203 11:13534623-13534645 AGCCAAGTGGTCTTGCTCAGTGG - Intergenic
1078809443 11:14743513-14743535 AGCCCAGTGGTCTAGCTCAGTGG - Intronic
1079262547 11:18897488-18897510 AGCCAGGTGGTCTAGCTCAGTGG - Intergenic
1079799797 11:24854571-24854593 AGCCAAGTGGCCTAGCTCAGCGG - Intronic
1080058447 11:27931939-27931961 TGCCCAGTGCTGTGGCTCAGTGG - Intergenic
1080710041 11:34738021-34738043 AGCCGAGTGATCTTGCTCAGTGG + Intergenic
1081118269 11:39232267-39232289 AGCCAAGTGGTCTTGCTCAGAGG + Intergenic
1081221576 11:40469569-40469591 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
1081252363 11:40851080-40851102 AGCCAAGTGTTCTTGTTCAGTGG - Intronic
1081269345 11:41065093-41065115 AGCCAAGTGGTCTTGTTCAGTGG + Intronic
1081317745 11:41651036-41651058 AGCCAAGTGGTCTTGCTCAGCGG - Intergenic
1082872155 11:57953486-57953508 AGCCAAGTGGTCTAGCTCACTGG - Intergenic
1082876341 11:57992646-57992668 AGCCAAGTAGTCTTGCTCAGCGG - Intergenic
1082903617 11:58283239-58283261 AGCCAAGTGGTCTTGCTCAGTGG - Intergenic
1083062796 11:59891960-59891982 AGCCAAGTAGCCTTGCTCAGCGG - Intergenic
1083385540 11:62306607-62306629 AGCCAAGTGGTCTAGCTCAGCGG - Intergenic
1083516236 11:63261770-63261792 AGCCAAGTGGTCTAGCTCAATGG - Intronic
1086300353 11:85420888-85420910 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
1086410699 11:86541334-86541356 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
1086505283 11:87497882-87497904 AGCCAAGTGGTCTAGCTCAGCGG + Intergenic
1086907333 11:92433186-92433208 AGCCAAGTGGTCTTGTTCAGTGG - Intronic
1087305745 11:96487328-96487350 AGCCGAGTGGTCTGGCTCAGCGG + Intronic
1087427758 11:98012574-98012596 AGCCAAGTGGTCTCGCTCAGCGG + Intergenic
1087925125 11:103910767-103910789 ATCCAAGTGGTCTGGCTCAGTGG + Intronic
1087969458 11:104461620-104461642 TGCCAAGTGGTTTTGTTCAATGG - Intergenic
1088034628 11:105296607-105296629 AGCCTAGTGGTCTTGCTCAGCGG - Intergenic
1088066448 11:105726079-105726101 AGCCAAGTGGTCTTGCTCAGCGG + Intronic
1088078322 11:105878843-105878865 AGCCAAGTTGTCTAGCTCAGTGG - Intronic
1088294490 11:108277318-108277340 AGCCAAGTGGTCTAGCTCAGCGG - Intronic
1088307250 11:108423270-108423292 AGCCAAGTGGTCTAGCTCAGCGG + Intronic
1089766047 11:120766405-120766427 AGCCAAGTGGTCTTGCTCAGTGG - Intronic
1090533002 11:127610689-127610711 TGCAGAGTGGTTTTGCTAAAAGG - Intergenic
1090720395 11:129467236-129467258 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
1090740762 11:129658174-129658196 AGCCAAATGGTCTTGCTCATTGG + Intergenic
1090896127 11:130977041-130977063 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1202824704 11_KI270721v1_random:84378-84400 AGCCGAGTGGGCTGGCTGAGAGG - Intergenic
1091958737 12:4672421-4672443 AGCCAAGTGATCTGGCTCAGCGG + Intronic
1092304353 12:7283741-7283763 AGGCAAGTGGTCTAGCTCAGTGG + Intergenic
1092320716 12:7471782-7471804 AGCCAAGTGGTCTCACTCAGCGG + Intronic
1092567714 12:9685807-9685829 AGCCAAGTGGTCTTGCTCAGTGG - Intronic
1092581700 12:9849543-9849565 AGCCAAGTGGACTGGCTCAGTGG - Intergenic
1092637422 12:10466854-10466876 AGCCCAGTGGTATTGCTCAGTGG - Intergenic
1092638874 12:10481860-10481882 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1092690889 12:11108856-11108878 AGCCAAGTTGTCTAGCTCAGTGG + Intronic
1093333194 12:17868590-17868612 AGCCAAGTGGTCTCACTCAGCGG + Intergenic
1093402289 12:18761141-18761163 AGCCAAGTGGTCTAGCTTAGTGG + Intergenic
1093545066 12:20336563-20336585 AGCCAAGTGGTCTTGCTCAGTGG - Intergenic
1093610511 12:21149889-21149911 AACCAAGTGGTCTAGCTCAGTGG + Intronic
1094140044 12:27171827-27171849 GGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1095247883 12:39943706-39943728 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
1095322688 12:40848077-40848099 TGCCGAGTGGTATGGGTCTGTGG - Intronic
1095343658 12:41123093-41123115 TACAGAGAGGACTTGCTCAGAGG + Intergenic
1095356407 12:41280402-41280424 AGCCAAGTAGTCTTCCTCAGCGG + Intronic
1095406323 12:41870718-41870740 AGCCAAGTGGTCTTGCTCAGCGG + Intergenic
1095488473 12:42708380-42708402 AGCCAAGAGGTCTAGCTCAGCGG + Intergenic
1095595286 12:43951330-43951352 AGCCAAGTGGTCTTGCTCAGTGG + Intronic
1095646983 12:44558862-44558884 AGCCAAGTGGTCTAGCTCAGCGG + Intronic
1095674225 12:44897804-44897826 AGCCAAGTGGACTTGCTCAGTGG + Intronic
1095778858 12:46037068-46037090 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1095831486 12:46591613-46591635 AGCCAAGTGGTCTCGCTAAGTGG - Intergenic
1095920644 12:47526540-47526562 AGCCAAGTGGTCTCGCTCAGTGG - Intergenic
1095930913 12:47624331-47624353 AGCCAAGTGGTCTCGCTCAGTGG + Intergenic
1096484854 12:51972822-51972844 TGTAGAGTGGCCTTTCTCAGAGG + Intronic
1097526612 12:60745626-60745648 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
1097635210 12:62113944-62113966 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
1097654448 12:62343363-62343385 AGCCAAGTGGTCTCGCTCAGCGG - Intronic
1097898815 12:64853442-64853464 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
1097948821 12:65403558-65403580 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
1098151886 12:67555662-67555684 AGCCAAGCGGTCTGGCTCAGTGG - Intergenic
1098183197 12:67869826-67869848 AGCCAAGTGGTTTGGCTCAGCGG - Intergenic
1098706869 12:73702493-73702515 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
1098780153 12:74676573-74676595 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1098840012 12:75467076-75467098 AGCCAAGTGGTCTCACTCAGCGG - Intergenic
1098906665 12:76169797-76169819 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1099071386 12:78049171-78049193 AGCTAAGTGGTCTAGCTCAGTGG - Intronic
1099107879 12:78519110-78519132 AGCCAAGTGGTCTCACTCAGTGG + Intergenic
1099236120 12:80084227-80084249 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1099253733 12:80289848-80289870 AGCCAAGTGGTCTCACTCAGCGG - Intronic
1099486264 12:83232763-83232785 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1099551052 12:84043709-84043731 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1099744992 12:86690267-86690289 AGCCAAGTGGTCTTGCTTAGTGG - Intronic
1099798027 12:87422609-87422631 AGCCAAGTGGTGTTGCTCAGTGG - Intergenic
1099878417 12:88437160-88437182 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
1099897537 12:88667643-88667665 AGACAAGTGGTCTAGCTCAGTGG + Intergenic
1100896255 12:99185929-99185951 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
1101277572 12:103219102-103219124 AGCCAAGTGGTCTAGGTCAGTGG + Intergenic
1101488016 12:105185210-105185232 AGCCAAGTGGTCTTGCTCAGTGG - Intronic
1101601260 12:106212342-106212364 AGCCAAGTGGTCTGGCTCGGTGG - Intergenic
1103169171 12:118799093-118799115 AGTCAAGTGGTCTTGCTCAGTGG - Intergenic
1103231771 12:119337153-119337175 TGCAGAGTGGTCTTGCTAAGAGG - Intronic
1103255667 12:119539635-119539657 AGCCAAGTGGTCTAGCTCACTGG - Intronic
1104115616 12:125746498-125746520 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1106025792 13:25954044-25954066 AGCCAAGTAGTCTAGCTCAGTGG + Intronic
1106042127 13:26103450-26103472 AGCCAAGTGGTCTAGCTCAGCGG + Intergenic
1106335095 13:28776836-28776858 AGCCAAGTGGTCTAGCTCAGCGG - Intergenic
1106377456 13:29203464-29203486 AGCCAAGTGGTCTTGCTCAGTGG - Intronic
1106378822 13:29216326-29216348 AGCCAAGTGGTCTTGCTCAGCGG - Intronic
1106429409 13:29665761-29665783 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
1106874252 13:34054722-34054744 AGCCAAGTGATCTTGCTCAGCGG - Intergenic
1107243424 13:38264836-38264858 AGCCAAGTGGTCTTGGTCTGTGG + Intergenic
1107289843 13:38839908-38839930 AGCCAAGTGGTTTAGCTCAGTGG - Intronic
1107641980 13:42453122-42453144 AGCCAAGTGGTCTAGCTCCGTGG - Intergenic
1107648154 13:42516471-42516493 AGCCAAGTGATCTAGCTCAGTGG + Intergenic
1107674097 13:42776903-42776925 AGCCAAGTGGTCTTGCTCAGTGG - Intergenic
1107968861 13:45622334-45622356 AGCCAAGTGGTCTAGCTCAGAGG - Intergenic
1108030096 13:46220554-46220576 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
1108235030 13:48394440-48394462 AGCCAAGTGGTCTACCTCAGCGG + Intronic
1108236818 13:48416623-48416645 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
1108304590 13:49118543-49118565 AGCCAAGTGGTCTAGCTCAGCGG + Intronic
1108383792 13:49879563-49879585 AGCTGAGTGGTCTTGCTCAGCGG + Intergenic
1108599848 13:51983102-51983124 AGCCAAGTGGTCTAGCTCAGCGG + Intronic
1109033835 13:57230132-57230154 AGCCAAGTGGTCTTGCTGAATGG + Intergenic
1109195913 13:59377314-59377336 AGCCAAATGGTCTAGCTCAGCGG + Intergenic
1109293720 13:60505127-60505149 CGCCAAGTAGTCTAGCTCAGCGG + Intronic
1109615408 13:64828203-64828225 AGCCAAGTAGTCTGGCTCAGCGG + Intergenic
1109891149 13:68616810-68616832 AGCCAAGTGATCTAGCTCAGTGG + Intergenic
1109902811 13:68795819-68795841 AGCCAAGTGGTCTGGCTCAGTGG - Intergenic
1110389695 13:74959645-74959667 AGCTGAGTGGTCTAGCTCAGTGG + Intergenic
1110890272 13:80689781-80689803 AGTCAAGTGGTCTTGCTCAGTGG + Intergenic
1110968630 13:81733013-81733035 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1111114195 13:83754617-83754639 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
1111627935 13:90813381-90813403 AGCCAAGTGATCTTGTTCAGTGG + Intergenic
1111635058 13:90892874-90892896 AGCCAAGTGGTCTTACTCAGTGG + Intergenic
1112151902 13:96773356-96773378 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
1112165829 13:96918904-96918926 AGCCGAGTGGTCTTGCTCAGTGG + Intergenic
1112231595 13:97593408-97593430 AGTCAAGTGGTCTTGCTCAGTGG + Intergenic
1112546523 13:100376757-100376779 AGCCAAGTGGTCTTGCTCAGCGG - Intronic
1114341928 14:21754264-21754286 AGCCAAGTGGTCTGGCTTAGCGG + Intergenic
1114695497 14:24623667-24623689 AGCCAAGTGGTCATGTTCAGTGG - Intergenic
1114744966 14:25136909-25136931 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
1114817649 14:25979348-25979370 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1114870127 14:26645749-26645771 AGCCCAGTGGTCTAGTTCAGCGG - Intergenic
1115008199 14:28511722-28511744 AGCCAAGTGGTCTGGCTCAGTGG - Intergenic
1115043090 14:28955468-28955490 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1115357147 14:32460757-32460779 AGCCAAGTGGTCTTGCTCAGCGG + Intronic
1115538035 14:34391706-34391728 AGCCAAGTGGTCTAGCTCAATGG + Intronic
1115856279 14:37633075-37633097 AGCCAAGTGGTCTCGCTCAGTGG - Intronic
1115912176 14:38268908-38268930 AGCCAAGTGGTCTTGTTCAGCGG - Intergenic
1116775707 14:49178664-49178686 AGCTGAGTAGTCTTGCTCAGCGG + Intergenic
1117104252 14:52382341-52382363 AGTCAAGTGGTCTAGCTCAGTGG + Intergenic
1117121050 14:52568491-52568513 AGCCAAGTGGTGTAGCTCAGTGG + Intronic
1117172371 14:53113908-53113930 AGCCAAGTGGTCTCGCTCAGTGG + Intronic
1117299273 14:54407800-54407822 AGCTGAGTGGTCTTGCTCTGTGG - Intronic
1117617093 14:57545011-57545033 AGCCAGGTGGTCTGGCTCAGCGG - Intergenic
1117655455 14:57951472-57951494 AGCCAAGTGGTCTAGCTGAGTGG + Intronic
1117710681 14:58525748-58525770 AGCCAAGTGGTCTACCTCAGCGG + Intronic
1117850086 14:59958577-59958599 AGCCAAGTGGTCTTGCTCAGCGG - Intronic
1117859356 14:60073672-60073694 AGCCAAGTGATCTAGCTCAGTGG + Intergenic
1117930557 14:60837174-60837196 AGCCAAGTGGTCTAGCCCAGCGG - Intronic
1118516108 14:66530399-66530421 AGCCAAGTGGTCTAGCTCAGGGG - Intronic
1119018497 14:71084799-71084821 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
1120137263 14:80884846-80884868 AGCCAAGTGGTCTCACTCAGCGG + Intronic
1120201315 14:81540865-81540887 AACCAAGTGGTCTAGCTCAGTGG + Intergenic
1122119004 14:99541948-99541970 TGCCGTAGGGCCTTGCTCAGGGG - Intronic
1123480810 15:20629278-20629300 AGCCAAGTGGTCTAGCTCAATGG + Intergenic
1123637201 15:22371087-22371109 AGCCAAGTGGTCTAGCTCAATGG - Intergenic
1124666688 15:31598694-31598716 AGCCAAGTGGTCTGGCTCAGTGG + Intronic
1124893929 15:33758330-33758352 AGCCAAGTAGACTTGCTCAGCGG + Intronic
1124903416 15:33845579-33845601 TGCCCAGTGATCATGCTAAGTGG - Intronic
1125219535 15:37317560-37317582 AGCCAAGTGGTGTGGCTCAGTGG + Intergenic
1125227153 15:37408343-37408365 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1125288505 15:38119910-38119932 AGCCAAGTGTTCTAGCTCAGCGG + Intergenic
1125784279 15:42301541-42301563 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
1126050815 15:44683277-44683299 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
1126301301 15:47199352-47199374 TGCTGAGTAGTCTTGCTGGGTGG + Intronic
1126500564 15:49340069-49340091 AGCCAAGTGGTCTGGCTCAGCGG - Intronic
1127158031 15:56149898-56149920 AGTCAAGTGGTCTGGCTCAGCGG + Intronic
1127295099 15:57602118-57602140 TGCAGGGTGGTTTTGCTAAGAGG + Intronic
1127317889 15:57815048-57815070 AGCCAAGTGGTCTGGCTCAGTGG - Intergenic
1127373714 15:58363087-58363109 AGCCAAATGGTCTAGCTCAGTGG + Intronic
1128857536 15:71031946-71031968 AGCCAAGTGGTCTCACTCAGTGG - Intronic
1129126753 15:73448186-73448208 AGCCAAGTGGTCTGGCTCAGCGG + Intronic
1129495605 15:75977274-75977296 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
1129507975 15:76099032-76099054 AGCCAAGTGGTCTGGCTCAGTGG - Intronic
1129719792 15:77871845-77871867 GGCCGCGTGGCCTTGCTCACTGG - Intergenic
1130724012 15:86419651-86419673 AGCCAAGTGGCCTAGCTCAGTGG + Intronic
1132096398 15:98988178-98988200 AGCCAAGTGGTCTGACTCAGTGG + Intronic
1132442894 15:101886182-101886204 AGCCAAGTGGTCTGGCTCGGCGG - Intergenic
1133901828 16:9982846-9982868 TTCCCAGTGGTCTCCCTCAGTGG + Intronic
1135737000 16:24939748-24939770 AGCCGAGTGGAGTTGCTCAGGGG - Intronic
1138706469 16:58920594-58920616 AGCTAAGTGGTCTAGCTCAGTGG - Intergenic
1138843670 16:60539226-60539248 AGCCAAGTGGTCTTGCTTAGTGG - Intergenic
1138886895 16:61090957-61090979 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1140165219 16:72543694-72543716 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1141246129 16:82309365-82309387 ATCCAAGTGGTCTAGCTCAGTGG - Intergenic
1144434136 17:15224054-15224076 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1146746348 17:35333879-35333901 AGCCAAGTGGTCTAGCTCAGCGG - Intergenic
1146817431 17:35954040-35954062 AGCCAAGTGGTGTTGCTCAGCGG - Intergenic
1147534818 17:41313176-41313198 TGCCGAGTTGTTTTGCAAAGTGG - Intergenic
1148403262 17:47386586-47386608 AGCCAAGTGGTCTCGCTCAGCGG - Intronic
1148967365 17:51447160-51447182 AGCCAAGTGCTCATGCTCAGCGG + Intergenic
1148981019 17:51574895-51574917 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1149281292 17:55108360-55108382 AGCCAAGGGGTCTAGCTCAGTGG - Intronic
1151064202 17:71131946-71131968 AGCCAAGTGGTCTAGCTCAGCGG - Intergenic
1151264678 17:72945680-72945702 TGCCTAGTGTTCTTGAGCAGGGG + Intronic
1152676170 17:81642457-81642479 TGCCAAGTGGCCTTGCCCTGAGG + Intronic
1153313429 18:3700076-3700098 AGCCAAGTGGTCTAGCTCAGCGG - Intronic
1153702597 18:7711520-7711542 AGCCAAGTGGTCTAGTTCAGTGG + Intronic
1155006672 18:21735562-21735584 AGCCAAGTGGTCTGGCTCAGCGG + Intronic
1155172624 18:23278160-23278182 TGCCCAGTGGTTTTGATCAGTGG - Intronic
1155384921 18:25266964-25266986 AGCCAAGTGGTCTGGCTCAGCGG + Intronic
1155395307 18:25380274-25380296 AGCTGGGTGGTCTTGCTCAGTGG + Intergenic
1155665199 18:28299476-28299498 AGCCAAGTGGTCTGGCTCGGTGG - Intergenic
1156188393 18:34690097-34690119 AGCCAAGTGGTCTTGCTCAGCGG - Intronic
1157034766 18:43958262-43958284 TGCCTAGAGATCTTCCTCAGAGG + Intergenic
1157071731 18:44416409-44416431 AGCCAAATGGTCTAGCTCAGCGG + Intergenic
1157178887 18:45477936-45477958 AGCCAAGTGGTCTAGGTCAGCGG - Intronic
1158659362 18:59372070-59372092 AGCCAAGTGGTCTTGCTCAGCGG - Intergenic
1158853357 18:61517807-61517829 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
1159254707 18:65931123-65931145 AGCAGAGTGGTCTTGCTTAGTGG + Intergenic
1159581310 18:70236905-70236927 AGCCGAGTGGCCTTGCTCAGTGG + Intergenic
1159661246 18:71098069-71098091 AGCTGAGTGGTCTTACTCAGTGG - Intergenic
1159690608 18:71482961-71482983 AGCCAAATGGTCTTGCTCAGAGG - Intergenic
1159901751 18:74053440-74053462 AGCTGAGTGGCCTTGCTCAGTGG + Intergenic
1160524845 18:79529624-79529646 TGCCAAATGTTTTTGCTCAGAGG + Intergenic
1165254606 19:34568168-34568190 AGCCAAGTGGTCTAGTTCAGTGG - Intergenic
1166263173 19:41657224-41657246 AGCTGAGTGGTCTTGCTCAGTGG + Intronic
925729176 2:6905108-6905130 AGCCAAGTGCTCTTGCTCAGCGG - Intergenic
927182777 2:20458793-20458815 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
928750625 2:34466694-34466716 AGCCAAGTGGTCTAGCCCAGTGG + Intergenic
929257764 2:39830931-39830953 AGCCCAGTGGTCTAGCTCAGCGG - Intergenic
930176068 2:48302894-48302916 AGCCAAGTGGTCTTGTTCAGCGG - Intergenic
930476669 2:51891338-51891360 AGCCAAGTGGTCTACCTCAGTGG - Intergenic
930925722 2:56816317-56816339 AGCCAAGTGGTCTCGCTCAGTGG + Intergenic
931030382 2:58168637-58168659 CGCCAAGTGGTCTATCTCAGTGG + Intronic
931212105 2:60207283-60207305 AGCCAAGTGGTCTTGCTTAGCGG - Intergenic
931479151 2:62622221-62622243 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
931480376 2:62633473-62633495 AGCCAAGTGGTCTAGCTTAGTGG + Intergenic
931538651 2:63304786-63304808 AGCCAGGTGGTCTAGCTCAGCGG + Intronic
931566427 2:63620210-63620232 AGCCAACTGGTCTAGCTCAGCGG + Intronic
931814819 2:65890155-65890177 GCCTGAGTGGTCTTGCTTAGTGG + Intergenic
932646802 2:73511139-73511161 AGGCAAGTGGTCTAGCTCAGTGG - Intronic
932913870 2:75834178-75834200 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
932938972 2:76139664-76139686 AGCCAAATGGTCTAGCTCAGTGG - Intergenic
933324225 2:80815320-80815342 AGCCAAGTGGTCTTGCTGAGGGG + Intergenic
933413221 2:81951157-81951179 AGCCAAGTGGTCTAACTCAGCGG - Intergenic
936448338 2:112614843-112614865 AGCCAAGTGGTCTGGCTCGGCGG - Intergenic
937188418 2:120068394-120068416 GGCCAAGTGGTCTAGCTCAGTGG + Intronic
937340833 2:121089354-121089376 TGCCAAGTGGGCTGACTCAGAGG - Intergenic
937465037 2:122125083-122125105 AGCCAAGTGGTCTGGCTCGGTGG - Intergenic
937526111 2:122772264-122772286 AGCCAAGTGGTCTCACTCAGGGG + Intergenic
937573500 2:123391862-123391884 AGCCAAGTGGTCTGGCTCAGCGG + Intergenic
937893283 2:126956786-126956808 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
938144724 2:128823876-128823898 AGCCAAGTAGTCTAGCTCAGTGG + Intergenic
939033253 2:137101577-137101599 AGCCAAGTGGTCTAGCTCAGCGG + Intronic
939180370 2:138796126-138796148 AGCCAAGTTGTCTTGCTCAGTGG + Intergenic
939508008 2:143072762-143072784 TGCAGAGTTTTCTTGCCCAGTGG + Intergenic
939876708 2:147586411-147586433 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
939937779 2:148313593-148313615 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
939941985 2:148362174-148362196 AGCCAAGTGGTCTAGCTCAGCGG + Intronic
939946904 2:148421619-148421641 AGCCAAGTGGTCTGGCTCGGCGG + Intronic
940054550 2:149500166-149500188 AGCCAAGTGGTCTTGCCCAGCGG - Intergenic
940114393 2:150192364-150192386 AGCTGAGTGCTCTTGCACAGCGG + Intergenic
940124831 2:150311481-150311503 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
940408108 2:153328758-153328780 AGCCGAGTGGTCTTGCTGAGCGG - Intergenic
940417839 2:153443000-153443022 AGCCAAGTGGTCTAACTCAGTGG - Intergenic
940565181 2:155351497-155351519 AGCCAAGTGGTCTCACTCAGCGG - Intergenic
940594023 2:155767023-155767045 AGCAAAGTGGTCTGGCTCAGTGG - Intergenic
940757925 2:157704667-157704689 AACCTAGTGGTCTAGCTCAGTGG + Intergenic
941276570 2:163497875-163497897 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
941478034 2:165971971-165971993 AGCCAAGTGGTCTCACTCAGTGG + Intergenic
942010877 2:171761487-171761509 AGCCAAGTGGTCTGGCTCGGTGG - Intergenic
942199883 2:173560103-173560125 AGCCAAGTGATCTAGCTCAGCGG + Intergenic
942323117 2:174753347-174753369 TGCTGAGTGGGCGTGCGCAGTGG - Intronic
942411021 2:175709306-175709328 AGCCAAGTACTCTTGCTCAGTGG + Intergenic
942431310 2:175914253-175914275 AGCCAAGTTGTCTTGCTCAGCGG - Intergenic
942898735 2:181089407-181089429 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
943129952 2:183842062-183842084 AGCCGAGTGGTCTAGCTCAGTGG + Intergenic
943408779 2:187520101-187520123 AGCCAAGTGGTCTAGCTCAACGG - Intronic
943836804 2:192524661-192524683 AGCCAAGTGGTCTCGCTCAGTGG + Intergenic
944267888 2:197748421-197748443 AGCCAAGTGGTCTTGCTCAGTGG + Intronic
944292020 2:198018419-198018441 AGCCAAGTGGTCTTGCTCAATGG + Intronic
944347370 2:198684979-198685001 AGCCAAGTGGTCTGGCTCAGCGG + Intergenic
944764337 2:202849320-202849342 AGCCAAGTGGTCTCGCTCAGTGG + Intronic
945409156 2:209488475-209488497 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
945927389 2:215819513-215819535 AGCCAAGTGGTCTAGCTCAGCGG + Intergenic
946912975 2:224485306-224485328 AGCCAAGTGGTCTTACTCAGTGG + Intronic
947225863 2:227839641-227839663 ACCCAAGTGGTCTTGCTCAGTGG - Intergenic
947681438 2:232037487-232037509 AGCCAAGTGGTCTAGCTCAGCGG - Intronic
947818637 2:233055212-233055234 TCCCGGCTGGTCTTCCTCAGTGG + Intergenic
948687558 2:239678351-239678373 TGCCCAGTGCTCTTGCTGAGTGG - Intergenic
1168938775 20:1691087-1691109 AGCCAAGTGGTTTAGCTCAGTGG + Intergenic
1169397056 20:5241672-5241694 AGCCAAGTGGTCTAGCTCAGGGG - Intergenic
1169421350 20:5463331-5463353 AGCCATGTGGTCTCGCTCAGTGG - Intergenic
1169771188 20:9202654-9202676 AGCTGACTGGTCTAGCTCAGTGG + Intronic
1169960358 20:11152713-11152735 AGCCAAGTAGTCTTGCTCAGCGG - Intergenic
1170294221 20:14806628-14806650 AGCCAAGTGGTCTTGCTCAGTGG + Intronic
1171000833 20:21414022-21414044 AGCCAAGTGATCTTGCTCAGTGG + Intergenic
1172690041 20:36783940-36783962 TGATGAGTGGCCTTGCACAGTGG + Exonic
1173318653 20:41968125-41968147 AGCAAAGTGGTCTGGCTCAGGGG - Intergenic
1173458754 20:43224926-43224948 TGCCGAGTGCTCTTGCAAAGGGG - Intergenic
1173751178 20:45478113-45478135 AGACAAGTGGTCTAGCTCAGCGG - Intronic
1173841077 20:46157702-46157724 TGCCCAGGGGCCCTGCTCAGTGG + Intergenic
1173937463 20:46879913-46879935 TGCTGCTTGATCTTGCTCAGAGG + Intergenic
1175791916 20:61745247-61745269 TGCAGACTGGTCTCACTCAGAGG - Intronic
1177129652 21:17240659-17240681 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1177517906 21:22178115-22178137 AGCCAAGTGGTCTCACTCAGTGG + Intergenic
1177540977 21:22493684-22493706 AGCCAAGTGGTCTAGCTCAGAGG + Intergenic
1177694563 21:24555077-24555099 AGCCGAGTGGTCTTGCTCAGTGG + Intergenic
1179343262 21:40532583-40532605 TGCCGAGGGCTTTAGCTCAGTGG + Intronic
1182077114 22:27502388-27502410 TGCCCAGTGGTATTGACCAGGGG - Intergenic
1184298569 22:43541721-43541743 TGCCCAGTGGTTTTGGCCAGTGG - Intronic
1185337077 22:50275512-50275534 TGCCCGGCGGTATTGCTCAGAGG + Exonic
949154995 3:816688-816710 AGCCAAGTGGTCTGGCTCGGGGG + Intergenic
949583350 3:5412708-5412730 AGCCAACTGGTCTAGCTCAGCGG + Intergenic
949594611 3:5530927-5530949 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
949641052 3:6036339-6036361 AGCTAAGTGGTCTAGCTCAGTGG - Intergenic
949801212 3:7906288-7906310 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
950597473 3:13997232-13997254 AGCCAAGTGGTCTAGCTCAGCGG - Intronic
950992011 3:17449422-17449444 AGCCAACTGGTTTTGCTCAGTGG + Intronic
951254508 3:20433066-20433088 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
951415147 3:22414493-22414515 AGCCAAGTGGTCTTGCTCAGTGG - Intergenic
951503691 3:23418010-23418032 AGCCAAGTGGTTTAGCTCAGCGG - Intronic
951687610 3:25362426-25362448 AGCCAAGTGGTCTTGCTCATTGG - Intronic
951741658 3:25931657-25931679 AGCCAAGTGGTCTTTCTCAGCGG + Intergenic
951777267 3:26324029-26324051 AGCCAAGTGGTCTGGCTTAGTGG - Intergenic
951826652 3:26876026-26876048 AGCCAAGTGGTCTTGCTCAGCGG + Intergenic
952607988 3:35172898-35172920 AGCCAAGTGGTCTCGCTCAGTGG - Intergenic
953047220 3:39304716-39304738 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
953264268 3:41370832-41370854 AGCCAAGTGGTCTTGCTCAGCGG + Intronic
954490636 3:50901426-50901448 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
954510513 3:51120918-51120940 AGCCAAGTAGTCTTGCTCAGCGG - Intronic
954700159 3:52446672-52446694 TGATGAGTGGGCTTGCGCAGGGG + Intergenic
955439743 3:58942762-58942784 AACCAAGTGGTCTTGCTCAGTGG + Intronic
955657847 3:61263761-61263783 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
955963049 3:64360595-64360617 TCCTGAGGCGTCTTGCTCAGTGG - Intronic
956005800 3:64776975-64776997 AGCCAAGAGGTCTTGCTCAGGGG + Intergenic
956207741 3:66771775-66771797 AGCCAAGTGGTCTAGCTCAGCGG - Intergenic
956220068 3:66893214-66893236 AGCCAAGTGGTCTTGCTCAGCGG + Intergenic
956383078 3:68686408-68686430 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
957009378 3:74986294-74986316 AGTCAAGTGGTCTAGCTCAGTGG - Intergenic
957011250 3:75008521-75008543 AGCCAAGTGGTCTTGCTCAGCGG - Intergenic
957695697 3:83635901-83635923 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
957776478 3:84761198-84761220 AGCCAAGTGGTCTAGTTCAGTGG + Intergenic
958520931 3:95184705-95184727 AGCTAAGTGGTCTTGCTCAGTGG - Intergenic
958622231 3:96576214-96576236 AGCCAAGTGGTCTGGCTCGGCGG - Intergenic
958693240 3:97495136-97495158 TCCCCAGCGGTCTTTCTCAGAGG + Intronic
958694584 3:97511129-97511151 AGCCAAGTGGTCTAGCTTAGTGG - Intronic
959074533 3:101735884-101735906 AGCCAAGTGGTCTAGCGCAGAGG + Intronic
959534590 3:107470548-107470570 AGCCAACTGGTCTAGCTCAGTGG + Intergenic
959800982 3:110495205-110495227 AGCCAAGTGGTCTTGCTCAGAGG + Intergenic
959881218 3:111447058-111447080 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
960075955 3:113485267-113485289 AGCCAAGTGGTCTGGCTCAGCGG + Intronic
960177261 3:114532175-114532197 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
960579816 3:119267362-119267384 AGCCAAGTGGTCTCGCTCAGTGG + Intergenic
960760107 3:121063943-121063965 ATCCAAGTGGTCTAGCTCAGTGG - Intronic
960763325 3:121097261-121097283 AGCCAAGTGGTCTGGCTCGGTGG - Intronic
960773170 3:121217134-121217156 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
960827869 3:121811454-121811476 AGCCAAGAGGTCTTGTTCAGCGG + Intronic
961310574 3:125996767-125996789 AGCCAAGTGGTCTGGCTCAGTGG + Intergenic
961605423 3:128091218-128091240 TGCTGAGTGGGCTGGCTGAGTGG + Intronic
961740292 3:129029104-129029126 GGCCGAGTGGTGTTGGTCAGGGG - Intronic
961897431 3:130180238-130180260 TGCCCAGTGGTCTATCTAAGAGG - Intergenic
961977501 3:131042299-131042321 AGCCAAGAGGTCTTGCTCAGCGG + Intronic
961998267 3:131269220-131269242 AGCCAAGTGGTCTAGCTCAGCGG - Intronic
962064367 3:131963428-131963450 AGCCAAGTGGTCTCACTCAGTGG + Intronic
962156848 3:132956908-132956930 AGCCAAGTGGTCTATCTCAGTGG + Intergenic
962512330 3:136114472-136114494 AGCCAAGTGGTCTGGCTCAGTGG + Intronic
962634796 3:137319539-137319561 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
962642373 3:137400774-137400796 AGCCAACTGGTCTAGCTCAGCGG - Intergenic
962666029 3:137654394-137654416 AGCCAAGTGGTCTGGTTCAGCGG + Intergenic
963013980 3:140803238-140803260 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
963481451 3:145879640-145879662 AGCCAAGTTGTATTGCTCAGTGG - Intergenic
963629308 3:147713113-147713135 AGCCAAGTGGTCTTGCTCAGTGG - Intergenic
963898647 3:150712330-150712352 AGCCAAGTGGACTAGCTCAGCGG + Intergenic
963976307 3:151483989-151484011 AGCCAAGTGGTCTGGCTCAGCGG + Intergenic
964053082 3:152419800-152419822 AGCCAAGTGGTCTTGCTCAGCGG + Intronic
964053283 3:152421351-152421373 AGCCGAGTGTTCTTGCTCAGTGG + Intronic
965017390 3:163174905-163174927 AGCCAAGTGGTCTAGCTCAATGG + Intergenic
965025485 3:163296954-163296976 AGCTAAGTGGTCTAGCTCAGTGG + Intergenic
965324750 3:167289773-167289795 AGCCAAGTGGTCTGGCTCATCGG + Intronic
965497253 3:169413575-169413597 AGCCAGGTGGTCTTGCTCAGTGG + Intronic
965618743 3:170621607-170621629 AGCCGAGTGATCTTGCTCAGTGG - Intronic
965801319 3:172496865-172496887 AGCCCAGTGGTCTTGCTCAGTGG - Intergenic
965880440 3:173382338-173382360 AGCCAAGTGGTCTAGCTCAGCGG + Intergenic
966201497 3:177363065-177363087 TGCAGAGTGGTCTTTCCCTGTGG - Intergenic
966255123 3:177908659-177908681 AGCCAAGTGGCCTAGCTCAGCGG + Intergenic
966291181 3:178361295-178361317 AGCCAAGAGGTCTTGCTCAGTGG + Intergenic
966533317 3:181004461-181004483 AGCCAAGTGGTCTAGCTCACTGG - Intergenic
966637932 3:182156659-182156681 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
966854796 3:184186500-184186522 TGCCCAGGCGTCTTGCACAGCGG + Exonic
967419587 3:189258955-189258977 AGCCAAGTGGTCTTCCTCAGTGG - Intronic
967562678 3:190934972-190934994 AGCCAAGTGATCTAGCTCAGCGG - Intergenic
968706918 4:2083290-2083312 TGCAGAGTGGTCTGGATGAGTGG - Intronic
969164829 4:5298741-5298763 AGCCAAGTGGTCTTGCTCAGTGG - Intronic
969909204 4:10428023-10428045 AGTCAAGTGGTCTAGCTCAGTGG - Intergenic
970185383 4:13446320-13446342 AGCCAAGCGATCTTGCTCAGTGG - Intronic
970214544 4:13745328-13745350 AGCCAAGTGGTCTTGATCAGAGG - Intergenic
970304705 4:14719130-14719152 AGTCAAGTAGTCTTGCTCAGCGG + Intergenic
970412031 4:15818041-15818063 AGCCAAGTGGTCTCGCTCAGCGG + Intronic
970679358 4:18489356-18489378 AGCCAAGTGGTCTCGCTTAGTGG + Intergenic
970727166 4:19060337-19060359 AGCCAAGTGGTTTTCCTCAGTGG + Intergenic
971151427 4:24036312-24036334 TGCCAAGTGGTTTTGCACAGTGG - Intergenic
971430078 4:26556473-26556495 AGCCAAGTTGTCTAGCTCAGTGG - Intergenic
971746478 4:30587196-30587218 AGCCAAGTGGTCTGGCTCAGCGG - Intergenic
971883228 4:32409572-32409594 AGCCAAGTGATCTAGCTCAGTGG + Intergenic
971943212 4:33241525-33241547 AGCCAGGTGGTCTTCCTCAGTGG - Intergenic
972219306 4:36935808-36935830 ATCCAAGTGGTCTAGCTCAGTGG + Intergenic
972962725 4:44473899-44473921 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
973272986 4:48280101-48280123 AGCCAAGTGGTCTAGCTCTGTGG + Intergenic
973321803 4:48817615-48817637 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
973556828 4:52092158-52092180 AGCCAAGAGGTCTGGCTCAGCGG - Intronic
973798378 4:54451387-54451409 AGCCAAGTGGTCTAGCTCAGCGG + Intergenic
974161737 4:58149739-58149761 AGCCAGGTGGTCTGGCTCAGTGG + Intergenic
974265761 4:59584187-59584209 AGCCAAGTGGTCTGGCTCAGTGG - Intergenic
974280007 4:59780324-59780346 AGCCAACTGGTCTTGCTCTGTGG + Intergenic
974326320 4:60419313-60419335 AGCCAAGTGGTGTTCCTCAGCGG - Intergenic
974792983 4:66714083-66714105 TGCCAAGTGGTCTGGCTCTGTGG + Intergenic
974814716 4:66989470-66989492 AGCTAAGTGGTCTTGCTCAATGG - Intergenic
974946639 4:68536346-68536368 AGCCAAGTGGTCTCGCTTAGTGG - Intergenic
975104103 4:70548785-70548807 AGCCACGTGGTCTAGCTCAGCGG + Intergenic
975227499 4:71891598-71891620 AGCCAAATGGTCTTGCTCAGTGG + Intergenic
975245850 4:72119968-72119990 AGCCAAGTGGTCTGGCTCAGTGG + Intronic
975307590 4:72866975-72866997 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
975424991 4:74215154-74215176 AGCCAAGTGGTCTAGTTCAGCGG - Intronic
976061277 4:81130936-81130958 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
976363046 4:84202799-84202821 AGCCGAGTGGTCTTGCTCAGTGG + Intergenic
976370791 4:84286120-84286142 AGCCAACTGGTCTAGCTCAGCGG + Intergenic
976445994 4:85130068-85130090 AGCCAAGTGGTCTAGCTCTGTGG - Intergenic
976534344 4:86193707-86193729 AGCCAAGTGGTCTAGCTTAGGGG - Intronic
976655942 4:87489042-87489064 AGCCAAATGGTCTAGCTCAGTGG - Intronic
976669489 4:87636405-87636427 AGCCAAGTGGTCTTGTTCAGTGG + Intergenic
976809949 4:89089978-89090000 AGCCAAATGGTCTAGCTCAGCGG - Intronic
976903531 4:90208455-90208477 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
977154458 4:93555296-93555318 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
977425524 4:96863057-96863079 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
977500256 4:97828581-97828603 AGCCAAGTGGTCTGCCTCAGTGG + Intronic
977723499 4:100267725-100267747 AGCCAAGTGGTCTAGTTCAGTGG - Intergenic
977887869 4:102273133-102273155 AGCCAAGTGGTCTTGCTCAGCGG + Intronic
977897834 4:102384276-102384298 AGCCAAGTGGTCTAGCTTAGTGG - Intronic
977986162 4:103385583-103385605 GGCCAAGTGGTTTAGCTCAGAGG + Intergenic
977994440 4:103484944-103484966 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
978090271 4:104707040-104707062 AGCCGAGTGGTCTTGCTCAGTGG + Intergenic
978108253 4:104930747-104930769 AGCCAAGTGGTCTAGCTTAGAGG + Intergenic
978139054 4:105297133-105297155 AGCCAAGTGGTCTAGCTCAGAGG + Intergenic
978186077 4:105858362-105858384 AGCCGAGTGGTCTTGCTGAGCGG - Intronic
978236930 4:106471514-106471536 AGCCACGTGGTCTGGCTCAGTGG - Intergenic
978278345 4:106978692-106978714 AGCCAAATGGTCTAGCTCAGCGG - Intronic
978601435 4:110432118-110432140 AGCCAAATGGTCTAGCTCAGAGG - Intronic
978664281 4:111164216-111164238 AGTGGAGTGGTCTTGCTCAGCGG + Intergenic
978845579 4:113269227-113269249 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
978906649 4:114013120-114013142 AGCTGAGTGGTCTTGCTCAGAGG - Intergenic
979043665 4:115834445-115834467 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
979115266 4:116815285-116815307 AGCCAAGTGGTCTGGCTCAGTGG + Intergenic
979457580 4:120944255-120944277 AGCCAAGTGGTCTGGCTCAGTGG + Intergenic
979461624 4:120990647-120990669 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
979668297 4:123336637-123336659 AGCCAAGCAGTCTTGCTCAGTGG - Intergenic
979998727 4:127464106-127464128 AGTCAAGTGGTCTGGCTCAGCGG - Intergenic
980100332 4:128535819-128535841 AGCCAAGTGGTCTGGCTCAGTGG - Intergenic
980148733 4:129021378-129021400 AGCCAAGTGGTCTTGCTCGGCGG + Intronic
980157649 4:129126475-129126497 AACCAAGTGGTCTAGCTCAGCGG - Intergenic
980330403 4:131403537-131403559 AGCCAAGTGGTCTTGCTCAGTGG - Intergenic
980494187 4:133570257-133570279 AGCCAAGTGGTCTTGCTCAGTGG - Intergenic
980633939 4:135473897-135473919 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
980888144 4:138785578-138785600 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
980908452 4:138972111-138972133 TGCTCTGTGGTCTTGCTCTGTGG - Intergenic
981133998 4:141189851-141189873 AGCCAAGTGGTCTTGCTCAGTGG - Intronic
981296640 4:143140554-143140576 AGCCAAGTCGTCTAGCTCAGTGG + Intergenic
981789644 4:148521858-148521880 AGCACAGTGGTCTAGCTCAGCGG - Intergenic
981794961 4:148585549-148585571 AGTCCAGTGGTCTAGCTCAGCGG - Intergenic
981885321 4:149666615-149666637 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
981939919 4:150271403-150271425 AGCCAAGTGGTCTGGCTCGGTGG + Intronic
981939948 4:150271546-150271568 AGCCAAGTGGTCTGGCTCGGTGG + Intronic
982393605 4:154892181-154892203 AGCCAAGTGGTCTTGCTCAGCGG + Intergenic
982725620 4:158902937-158902959 AGCCGAGTGGTCTGGCTCAGTGG - Intronic
982733295 4:158979306-158979328 AGCCAAGTGGTCTGGCTCATCGG - Intronic
982815405 4:159877859-159877881 AGCCAAGTGGTCTCGCTTAGTGG - Intergenic
982909239 4:161118199-161118221 AGCCAAGTGGTCTTGCTCAGAGG - Intergenic
983179434 4:164630629-164630651 AGCCAAGTGGTCTTGTTCAGTGG + Intergenic
983327716 4:166279496-166279518 TGCAGTGTGGGCTGGCTCAGAGG + Intergenic
983543271 4:168935449-168935471 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
983596327 4:169472064-169472086 ACCCGAGTGGTATTGCTCAGCGG - Intronic
983840843 4:172455396-172455418 AGCCAAGTGGTCTAGCTCAGCGG + Intronic
983949467 4:173622506-173622528 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
984124128 4:175785171-175785193 TGGCGATTGGACTTGGTCAGGGG - Intronic
984269845 4:177537063-177537085 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
984493661 4:180468612-180468634 AGCCAAGTGGTCTTGCTCAATGG + Intergenic
984709896 4:182876221-182876243 AGCCGAGTGGGCATTCTCAGGGG + Intergenic
984902935 4:184600868-184600890 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
985194033 4:187408384-187408406 AGCCAAGTGGTCTAGCTCAGCGG - Intergenic
986110339 5:4709828-4709850 AGCCAAGTGGTTTAGCTCAGTGG + Intergenic
986358527 5:6952283-6952305 AGAAAAGTGGTCTTGCTCAGTGG + Intergenic
986484326 5:8220200-8220222 AGCCAAGTGGTCTTCCTCAGTGG + Intergenic
986516133 5:8565729-8565751 TGCTGGGTGGTATTACTCAGAGG + Intergenic
986920538 5:12674219-12674241 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
987019244 5:13852557-13852579 AGCCAGGTGGTCTTGCTCAGTGG + Intronic
987528220 5:19080625-19080647 CGCCAAGTGGTCTGGCTCAGCGG - Intergenic
987720589 5:21627857-21627879 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
988618199 5:32795198-32795220 GGCCAAGTGATCTAGCTCAGAGG + Intergenic
988628034 5:32898817-32898839 AGCCAAGTGGTCTAGCTCAAAGG - Intergenic
988970771 5:36465422-36465444 AGCCATGTGGTCTTGCTCAGTGG + Intergenic
989320729 5:40131004-40131026 AGCCAACTGGTCTTGCTCAGTGG - Intergenic
990231347 5:53716170-53716192 AGCCAAGTGGTCTCACTCAGCGG + Intergenic
990745872 5:58959040-58959062 ATCCAAGTGGTCTAGCTCAGCGG - Intergenic
990837788 5:60041994-60042016 AGCCAAGTGGTCTAGCTCAGCGG + Intronic
990897608 5:60715867-60715889 AGCCAAGTGTTCTTGCTCAGTGG - Intergenic
991110757 5:62896788-62896810 AGCCAAGTGGTCTTGCTCAGTGG - Intergenic
991223557 5:64243277-64243299 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
991242318 5:64474237-64474259 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
991397767 5:66222799-66222821 AGCCAAGTGATCTTGCTCAGAGG - Intergenic
991652053 5:68865455-68865477 AGCCGAGTGGTCTAGCTCAGCGG + Intergenic
991934749 5:71790287-71790309 AGCTGAGTGGTCTTGCTTAGTGG + Intergenic
992077845 5:73207257-73207279 AGCCAAGTGGTCTAGCTCACTGG + Intergenic
992287269 5:75248332-75248354 AGCCAAGTGGTCTGTCTCAGCGG + Intergenic
992316985 5:75566318-75566340 AGCTGAGTGGTCTGGCTCAGCGG - Intronic
992506093 5:77389024-77389046 AGCCAAGTGGTCTGGCTCAGCGG - Intronic
992740635 5:79770255-79770277 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
992908697 5:81373556-81373578 AGCCGAGTGGTCTGGCTTGGCGG + Intronic
992976916 5:82130296-82130318 AGCCAAGTGGTCTTGCTCAGTGG - Intronic
993081127 5:83302161-83302183 AGCCAAGTGGCCTTGCTCAGCGG - Intronic
993255735 5:85588179-85588201 AGCCGAGTGGTCTTGCTCAGTGG - Intergenic
993265457 5:85721493-85721515 AGCCGAGTGGTCTAGTGCAGTGG + Intergenic
993402673 5:87472800-87472822 AGCCAAGTGGTCTCACTCAGCGG + Intergenic
993410497 5:87567479-87567501 TGTCGAGTGGTCTTGCTCAGCGG - Intergenic
993455267 5:88120420-88120442 AGCCAAGTGGTCTCACTCAGCGG + Intergenic
993757639 5:91751165-91751187 AGCCACGTGGTCTTGCTCAGTGG - Intergenic
993911535 5:93690241-93690263 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
994005178 5:94828893-94828915 AGCCAAGTTGTCTTGCTCAGTGG - Intronic
994015029 5:94955454-94955476 TGCCGAGTGGTCTTGCTCAGTGG + Intronic
994233550 5:97336342-97336364 GCCCAAGTGGTCTAGCTCAGCGG - Intergenic
994378057 5:99037796-99037818 AGCCAAGTGGTCTGGCTCGGTGG + Intergenic
994438087 5:99763748-99763770 AACCGAGTGGTCTTGCTCAGCGG - Intergenic
994991329 5:107000210-107000232 AGCCAAGTGGTCTTTTTCAGTGG - Intergenic
995464405 5:112436173-112436195 AGTCAAGTGATCTTGCTCAGTGG + Intergenic
995471209 5:112503780-112503802 AGCCAAGTGGTCTAGCTCAGCGG + Intergenic
995475025 5:112539143-112539165 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
995808543 5:116080366-116080388 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
996129925 5:119769716-119769738 AGTCAAGTGGTCTTGCTGAGTGG + Intergenic
996427933 5:123335299-123335321 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
997220388 5:132157393-132157415 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
997252272 5:132398314-132398336 AGCCAGGTGGTCTTGCTCAGCGG + Intergenic
997809551 5:136953996-136954018 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
998186363 5:139982819-139982841 TGAGGAGTAGTCTTGCCCAGGGG + Intronic
998752100 5:145333722-145333744 AGCAAAGTGGTCTAGCTCAGTGG - Intergenic
998972802 5:147611136-147611158 AGCCAAGTGGTCTTGCTCAGCGG - Intronic
999556794 5:152752140-152752162 AGCCAAACGGTCTTGCTCAGTGG + Intergenic
999602577 5:153283087-153283109 AGCCAAGTGGTCTTGCTCAGCGG + Intergenic
999983910 5:156984626-156984648 AGCCAAGTGGTCTAACTCAGCGG + Intergenic
1000194788 5:158947139-158947161 AGCCAAGTGGTTTTGCTCAGTGG - Intronic
1000294412 5:159900711-159900733 TGCCAGCTGGGCTTGCTCAGTGG - Intergenic
1000417498 5:160998210-160998232 AGCCAAGTGGTCTTGCTTAGCGG - Intergenic
1000582233 5:163048594-163048616 AGCCAAGTAGTTTTGCTCAGTGG - Intergenic
1000590026 5:163146918-163146940 AGCCGAGTGCTCTTGCTCAGGGG + Intergenic
1000660501 5:163932975-163932997 AGCCAAGAGGTCTTGCTCAGTGG + Intergenic
1000860435 5:166450479-166450501 AGCCAAGTGATCTAGCTCAGTGG - Intergenic
1001346400 5:170903436-170903458 AGCCAAGTGGTCTAGCGCAGAGG - Intronic
1001730123 5:173947397-173947419 TGTAGAGGGGGCTTGCTCAGAGG + Intronic
1002673517 5:180889887-180889909 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1002677149 5:180926510-180926532 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
1002734823 5:181377515-181377537 AGCCAAGTGGTCTGGCTCGGCGG - Intergenic
1002749705 6:96605-96627 AGCCAAGTGGTCTGGCTCGGCGG + Intergenic
1003713524 6:8619765-8619787 AGCCATGTGGTCTAGCTCAGCGG - Intergenic
1004593208 6:17073637-17073659 AGCCAAGTGGTCTTGCTCAATGG + Intergenic
1005274170 6:24198695-24198717 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
1005376305 6:25185986-25186008 AGCCAAGTGGTCTCACTCAGTGG - Intergenic
1006199945 6:32279404-32279426 AGCCAAGTGGTCTCGCTCAGTGG + Intergenic
1008407615 6:51136392-51136414 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1008865409 6:56204172-56204194 AGCCAAGTGGTCTAGCTCCGTGG + Intronic
1009290087 6:61870069-61870091 AGCCAAGTGGTCTGGCTCAGTGG + Intronic
1009455250 6:63848871-63848893 AGCCAAGTGGTCTTGCTCAGCGG + Intronic
1009727880 6:67558294-67558316 AGCCAAGTGGTCTGACTCAGCGG - Intergenic
1010039166 6:71361273-71361295 AGCCAAGTGGTCCAGCTCAGCGG - Intergenic
1010681829 6:78807597-78807619 AGCCAAGTGGTCTGGCTCGGTGG - Intergenic
1011120070 6:83942651-83942673 AGCCAGGTGGTCTTGCTCAGCGG + Intronic
1011239218 6:85253078-85253100 TGCCCATTGGTCTTGATCAAGGG - Intergenic
1011298948 6:85853846-85853868 AGCCAAGTGGTCTAGCTAAGTGG - Intergenic
1011301461 6:85878860-85878882 AGCCAAGAGGTCTAGCTCAGTGG - Intergenic
1011340320 6:86306838-86306860 AGCCAAGTGGTCGAGCTCAGTGG - Intergenic
1011387698 6:86815584-86815606 AGCCAAGTTGTCTAGCTCAGTGG - Intergenic
1012127950 6:95454201-95454223 AGTCAAGTGGTCTTGCTCAGTGG - Intergenic
1012207486 6:96478848-96478870 AACCAAGTGGTCTAGCTCAGCGG - Intergenic
1012302899 6:97612294-97612316 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1012597136 6:101054101-101054123 AGCCAAGTGGCCCTGCTCAGCGG - Intergenic
1012802183 6:103844523-103844545 TGCAAAGTGGCCATGCTCAGTGG - Intergenic
1013025021 6:106263032-106263054 AGTCAAGTGGTCTCGCTCAGTGG + Intronic
1013390221 6:109679144-109679166 AGCCAAGTGGTCTAGCTCAGCGG + Intronic
1013625684 6:111934917-111934939 AGCCAAGTGGTCTAGCTCAGCGG - Intergenic
1013682582 6:112541520-112541542 AGCCAAATGGTCTAGCTCAGAGG + Intergenic
1013939575 6:115645337-115645359 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1013956898 6:115852489-115852511 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1014122862 6:117746214-117746236 AGCCAAGTGGTCTAGTTCAGTGG + Intergenic
1014177044 6:118342496-118342518 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1014387080 6:120816146-120816168 AGTCAAGTGGTCTTGCTCAGTGG - Intergenic
1014527835 6:122522334-122522356 GGCTGAGTGGTCTTGCTCAGTGG - Intronic
1014569027 6:122986378-122986400 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1014753684 6:125280426-125280448 AGCCAAGTGGTCTTGATCAGTGG + Intronic
1014836568 6:126167067-126167089 AGCCAAGAGGTCTTGCTCAGTGG - Intergenic
1014922416 6:127228677-127228699 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1015108897 6:129569167-129569189 AGCCAAGTGTTCTAGCTCAGTGG + Intergenic
1015163036 6:130174129-130174151 AGCCAAGTGGTCTTGCTCAGTGG - Intronic
1015211302 6:130701807-130701829 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1015386959 6:132635313-132635335 AGTCAAGTGGTCTTGCTCAGAGG + Intergenic
1015623415 6:135156288-135156310 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1016111457 6:140230323-140230345 AGCCAAGTGGTCTGGCTCGGTGG + Intergenic
1016638721 6:146324345-146324367 AGCCAATTGGTCTAGCTCAGGGG - Intronic
1017322610 6:153111130-153111152 AGCCAAGTGGTCTAGCTCAGCGG + Intronic
1017571395 6:155748780-155748802 AGCCAAGTGTTCTAGCTCAGTGG + Intergenic
1017968720 6:159290487-159290509 AGCCAAGTGGTCTGGCTCAGTGG - Intergenic
1018108699 6:160513876-160513898 AGCCGAGGGGTCCAGCTCAGTGG + Intergenic
1018114650 6:160571827-160571849 AGCTAAGTGGTCTTTCTCAGTGG - Intronic
1018797658 6:167199828-167199850 AGCCAAGTGGTCTCACTCAGTGG - Intergenic
1019203689 6:170341448-170341470 AGCCAAGTGGTCTCACTCAGCGG - Intronic
1019239084 6:170649835-170649857 AGCCAAGTGGTCTGGCTCGGCGG - Intergenic
1020333393 7:7042324-7042346 AGCCGAGTGGTCTTGCCCAGTGG + Intergenic
1020338998 7:7089226-7089248 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1020358296 7:7301259-7301281 AGCCAAGTGGTCTTGCTCAGTGG - Intergenic
1020367246 7:7393881-7393903 TGCCAAGTGGTCTACTTCAGCGG - Intronic
1020391427 7:7662262-7662284 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
1020487682 7:8739078-8739100 AGCCAAGTGGTCTTGCTCAGTGG - Intronic
1020519603 7:9169341-9169363 AGCCAAGTGGTCTTGCTCAGTGG - Intergenic
1020557677 7:9690978-9691000 AGCCAAGCAGTCTTGCTCAGCGG + Intergenic
1020639882 7:10742108-10742130 AGCCAAGCGGTCTAGCTCAGTGG + Intergenic
1020874288 7:13673972-13673994 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1020935478 7:14458890-14458912 AGCCAAGTGGTTTAGCTCAGGGG + Intronic
1021014645 7:15517859-15517881 AGCCAAGTGGTCTTGCTCAGAGG + Intronic
1021099506 7:16571883-16571905 AGCCAAGTGGTCTAGCTCAGCGG + Intronic
1021167030 7:17354396-17354418 AGCCAAGTGGTCTAGCTCAGCGG - Intergenic
1021322298 7:19227089-19227111 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1023051772 7:36258775-36258797 AGCCAAGGGGTCTAGCTCAGTGG - Intronic
1023225651 7:37966297-37966319 TGCCGAGTACACGTGCTCAGGGG - Intronic
1024950526 7:54855979-54856001 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1024998544 7:55294866-55294888 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1027446087 7:78274892-78274914 AGCCAAGTGGTCTGGCTCAGCGG - Intronic
1027582864 7:80020313-80020335 AGCCAAGTGGTCTTCCTCAGTGG + Intergenic
1027790379 7:82633576-82633598 AGCCAAGTGGTCTGGCTCTGTGG + Intergenic
1027864590 7:83629741-83629763 AGCCAAGTAGTCTTGCTCAGTGG - Intronic
1028144279 7:87304544-87304566 AGCCAAGTGGTCTAGCTCAGCGG + Intergenic
1028630286 7:92926638-92926660 AACCAAGTGGTCTGGCTCAGCGG - Intergenic
1028648188 7:93121064-93121086 AGCCAAGTGGTCTAGCTCAGCGG + Intergenic
1028991236 7:97051097-97051119 AGCCAAATGGTCTTGCTCAGTGG + Intergenic
1029750103 7:102538413-102538435 TGCCGAGGGGGCTTCCTGAGGGG - Intronic
1029768054 7:102637521-102637543 TGCCGAGGGGGCTTCCTGAGGGG - Exonic
1029800948 7:102947000-102947022 TGCCCAGTGGTCTGGGTCAGAGG + Intronic
1029816959 7:103106438-103106460 AGCCAAGTGGTCTGGCTCAGCGG + Intronic
1029845272 7:103406131-103406153 AGCCAAGTGGTCTAGCTCAGCGG - Intronic
1029851126 7:103462698-103462720 AGACAAGTGGTCTAGCTCAGTGG - Intergenic
1030325863 7:108217871-108217893 AGCCAAGTGATCTAGCTCAGCGG - Intronic
1030612649 7:111706155-111706177 AGCCAAGTGGTCTAGCTCAGCGG - Intergenic
1031031823 7:116743415-116743437 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
1031397754 7:121293457-121293479 AGCTGAGTGGTCTTGCTCAATGG - Intronic
1031466800 7:122123155-122123177 TGCTTAGGGGTCTTGCTAAGTGG - Intronic
1031710988 7:125046489-125046511 AGCCAAATGGTCTAGCTCAGTGG + Intergenic
1031902733 7:127428700-127428722 AGCCAAGTGGTCTATCTCAGCGG - Intronic
1032295948 7:130638680-130638702 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
1032367696 7:131315586-131315608 AGTCAAGTGGTCTTGCTAAGTGG + Intronic
1032659769 7:133970297-133970319 AGCCAAGTGGTCTAGCTCAGCGG - Intronic
1032966434 7:137103577-137103599 AGCCAAGTGGTCTAGCTTAGCGG + Intergenic
1033525594 7:142210376-142210398 AGCCGAGTGCCCTTGCTCAGCGG + Intronic
1033680032 7:143584584-143584606 TGTCAAGTGGTCTGGCTCAGTGG + Intergenic
1033691802 7:143744858-143744880 TGTCAAGTGGTCTGGCTCAGTGG - Intergenic
1034314472 7:150117270-150117292 AGCCAAGTGGTCTTGCTCAGCGG + Intergenic
1034792424 7:153983499-153983521 AGCCAAGTGGTCTTGCTCAGCGG - Intronic
1035508688 8:156774-156796 AGCCAAGTGGTCTGGCTCGGCGG + Intergenic
1035710735 8:1712064-1712086 AGCCAAGTGGTCTGGCTCGGTGG + Intergenic
1035998332 8:4574075-4574097 AGCCAAGTGGTCTTGCTCAGTGG - Intronic
1036557993 8:9876776-9876798 AGCCAAGTGGTCTGGCTCAACGG + Intergenic
1037258300 8:16979770-16979792 AGCTGAGTGGTCTTGCTCAGCGG - Intergenic
1037285492 8:17294405-17294427 AGCCAAATGGTCTTGCTCAGCGG - Intronic
1037719634 8:21431542-21431564 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1038211558 8:25523229-25523251 AGCCAAGTGGTCTTGCTCAGCGG + Intergenic
1038917275 8:32037932-32037954 AGCCAAGCGGCCTTGCTCAGCGG - Intronic
1038936466 8:32257237-32257259 AGCCAAGTGATCTAGCTCAGCGG - Intronic
1039282958 8:36006600-36006622 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1040520112 8:48169320-48169342 AGCCCAGTGGTCTACCTCAGTGG - Intergenic
1041287282 8:56273707-56273729 AGCCAAGTGGTCTTTCTCAGCGG + Intergenic
1041323321 8:56637269-56637291 AGCCAAGTGGTCTAGCTCAGCGG - Intergenic
1041583974 8:59495041-59495063 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1041838351 8:62242189-62242211 AGCCAAGTGGTCCAGCTCAGCGG - Intergenic
1042110909 8:65380124-65380146 AGCCCAGTGGTCTAGCTCAGTGG + Intergenic
1042327182 8:67540956-67540978 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
1042349329 8:67761305-67761327 AGCCAAGTGGTCTGGCTCGGCGG + Intergenic
1042622732 8:70724334-70724356 AGCCAAGTGGTCTCACTCAGTGG - Intronic
1042753483 8:72184405-72184427 ATCCAAGTGGTCTCGCTCAGCGG + Intergenic
1042957320 8:74265199-74265221 TGCAGTGTGTTCATGCTCAGGGG + Intronic
1043036689 8:75208275-75208297 AGCCAAGTGGTCTCCCTCAGTGG - Intergenic
1043118165 8:76286506-76286528 AGCCAAGTGGTCTAGCTCGGTGG - Intergenic
1043253681 8:78106545-78106567 AGCCAAGTGGTCTCGCTCAGTGG - Intergenic
1043368285 8:79560605-79560627 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1043643865 8:82492042-82492064 TGCCTATTAGTCTTTCTCAGAGG - Intergenic
1043647257 8:82536319-82536341 AGCCGAGTGGTATTGCTCAGCGG - Intergenic
1043703598 8:83321973-83321995 AGCCAAATGGTTTTGCTCAGTGG + Intergenic
1044405253 8:91818931-91818953 AGCCAAGTGGTCTCGCTGAGCGG + Intergenic
1044595277 8:93953222-93953244 AACCAAGTGGTCTTGATCAGTGG - Intergenic
1044940271 8:97335092-97335114 GGCTGAGTGGTCTTGCTTAGTGG - Intergenic
1044961001 8:97530347-97530369 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
1045185198 8:99830552-99830574 AGCCAAGTGGTCTTACTCAGTGG - Intronic
1045199653 8:99967419-99967441 AGCCAAGTGGTCTCGCTCAGTGG + Intronic
1045390565 8:101710452-101710474 AGCCAAGTGGTCTTGCTCAGTGG + Intronic
1045618889 8:103951790-103951812 AGCCAAGTGGTCTGGCTCAGCGG + Intronic
1045839328 8:106561162-106561184 AGCCAAGTGGTCTTGCTCAGCGG + Intronic
1045883208 8:107065137-107065159 AGCCAAGTGGTCTGGCTCAGCGG - Intergenic
1046047989 8:108986511-108986533 AGACAAGTGGTCTAGCTCAGTGG - Intergenic
1046153495 8:110257831-110257853 AGCCAAGTGGTCTTGCTGAGCGG - Intergenic
1046428761 8:114093498-114093520 TTACGTGTGGTCTTGCTCAGCGG - Intergenic
1047121285 8:121908108-121908130 AGCCAAGTGGCCTCGCTCAGCGG + Intergenic
1047369596 8:124245503-124245525 AGCTGACTGGTCTTGCTCAGTGG - Intergenic
1048914137 8:139165626-139165648 GGCCAAGTGGTCTGGCTCAGTGG - Intergenic
1048939327 8:139384664-139384686 TGCCCAATTGTCCTGCTCAGTGG - Intergenic
1050031748 9:1393564-1393586 AGCCAAGTGGTCTTGCTCATTGG + Intergenic
1050300519 9:4253560-4253582 AGACAAGTGGTCTAGCTCAGCGG - Intronic
1050626410 9:7508558-7508580 TGCCTAGTGGTATTGATAAGTGG - Intergenic
1050637393 9:7626692-7626714 AACCAAGTGGTTTTGCTCAGCGG + Intergenic
1050973928 9:11912363-11912385 AGCTAAGAGGTCTTGCTCAGTGG - Intergenic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1051548712 9:18305394-18305416 AGCTAAGTGGTCTAGCTCAGGGG + Intergenic
1051571504 9:18563964-18563986 AGCCAAGTGGTCTAGCTTAGCGG - Intronic
1051611664 9:18967697-18967719 AGCCGAATGGTCTTGCTCAGCGG - Intronic
1051814303 9:21087411-21087433 AGCCAAGTGGTCTAGCTCAGCGG + Intergenic
1051863403 9:21651803-21651825 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1051940238 9:22496402-22496424 AGCCAAGTGTTCTAGCTCAGTGG - Intergenic
1052052734 9:23866556-23866578 AACCAAGTGGTCTAGCTCAGCGG - Intergenic
1052061564 9:23966604-23966626 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1052096605 9:24391433-24391455 AGCCAAGTGGTCTAGCTTAGGGG - Intergenic
1052146915 9:25061262-25061284 AGCCAAGTGGTCTTATTCAGCGG - Intergenic
1052326478 9:27220968-27220990 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
1052336410 9:27324565-27324587 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1053175521 9:35920075-35920097 TCCTGAGTGGCCTTGCTAAGTGG - Intergenic
1054719896 9:68594099-68594121 AGCCAAGTGGTCTAGCTTAGTGG - Intergenic
1054884932 9:70185832-70185854 AGCCAAGTGGTCTCACTCAGTGG - Intronic
1055125729 9:72716715-72716737 AGCCAAGTGGTCTGGCTCAGTGG - Intronic
1055210301 9:73783222-73783244 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1055338989 9:75261905-75261927 GGCCAAGTGGTCTTGCTCAGTGG - Intergenic
1055345063 9:75327099-75327121 AGCCAAGTGATCTTGCTCAGTGG - Intergenic
1055494562 9:76841505-76841527 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
1055571758 9:77623956-77623978 AGCCAAGTGGTCTAACTCAGAGG + Intronic
1055628742 9:78201136-78201158 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
1056121226 9:83491354-83491376 TGCCGAGTTTTCTTACTCCGTGG + Intronic
1056123722 9:83514150-83514172 AGCCAATAGGTCTTGCTCAGCGG + Intronic
1056302648 9:85258101-85258123 AGCCAAGTGGTCTAGCTCGGTGG - Intergenic
1056997791 9:91479598-91479620 AGCCAAGGGGTCTTGCTCAGTGG - Intergenic
1057460301 9:95254765-95254787 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
1058034600 9:100237310-100237332 AGCCAAGTGGTTTTGCTCAGTGG - Intronic
1058072893 9:100619563-100619585 AGCCAAGTGGTCTGACTCAGTGG - Intergenic
1058182499 9:101815704-101815726 AACCAAGTGGTCTTTCTCAGGGG + Intergenic
1058265782 9:102897610-102897632 AGCCAAGTGATCTTGCTCAGGGG + Intergenic
1059088834 9:111334487-111334509 AGCCAAGTGGTCTAGCTCAGCGG + Intergenic
1060245373 9:121941665-121941687 TGCCCAGTGCTTTTGTTCAGAGG + Intronic
1061042799 9:128149619-128149641 TGCAGAGGGACCTTGCTCAGAGG - Exonic
1062297591 9:135841036-135841058 AGGCAAGTGGTCTAGCTCAGTGG + Intronic
1062759289 9:138330125-138330147 AGCCAAGTGGTCTGGCTCGGCGG - Intergenic
1203599739 Un_KI270748v1:898-920 AGCCAAGTGGTCTGGCTCGGCGG - Intergenic
1186487855 X:9947232-9947254 TGCCGAGTGGTCACTGTCAGTGG + Exonic
1186599819 X:11024748-11024770 ATCCAAGTGGTCTAGCTCAGTGG - Intergenic
1186773326 X:12839310-12839332 AGCCAAGTGGTCTAGCTCAGCGG - Intergenic
1186774873 X:12854718-12854740 AGCCAAGTGGTCGGGCTCAGTGG - Intergenic
1187839955 X:23476851-23476873 AGCCAAGTGGTCTAGCTAAGTGG - Intergenic
1188193197 X:27197173-27197195 AGCCAAGTGGTCTTGCTCAGCGG + Intergenic
1188561259 X:31471103-31471125 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
1189039778 X:37530410-37530432 ATCCGAGCAGTCTTGCTCAGTGG - Intronic
1189189620 X:39088993-39089015 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1189210823 X:39280656-39280678 AGCCAAGTGGTCTAGCTCAGCGG - Intergenic
1189243335 X:39542354-39542376 AGCTAAGTGGTCTAGCTCAGCGG + Intergenic
1189754120 X:44253323-44253345 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
1190505860 X:51125414-51125436 AGCCAAGTGGTTCTGCTCAGTGG + Intergenic
1190959779 X:55234773-55234795 AGCTGAGTGGTCTTGCGCACTGG - Intronic
1190966431 X:55305671-55305693 AGCCAAGTGGTCTCGCTCAGCGG - Intergenic
1191024258 X:55896581-55896603 AGCCAAGTGGTCTATCTCAGTGG + Intergenic
1191094364 X:56659104-56659126 AGCCAAGTGGTCTTGCTCAGTGG - Intergenic
1191098990 X:56704884-56704906 AGCCAAGTGGTCTAGCGCAGTGG - Intergenic
1191132642 X:57030973-57030995 AGTCAAGTGGTCTCGCTCAGTGG - Intergenic
1191172141 X:57459017-57459039 AGCCAAGTGGTCTCGCTCAGTGG + Intronic
1191194420 X:57705858-57705880 AGCCAAGTGGTCTCACTCAGAGG + Intergenic
1191237882 X:58150841-58150863 AGCCAAGTGGCCTAGCTCAGTGG + Intergenic
1191631935 X:63331214-63331236 AACCAAGTGGTCTAGCTCAGTGG + Intergenic
1191657433 X:63613656-63613678 AGCCAAGTAGTCTAGCTCAGCGG + Intergenic
1191787727 X:64935014-64935036 AGCCAAGTAGTCTTGCTCAGTGG + Intronic
1191931368 X:66376571-66376593 AGCCAAGTGGTCTAGCTCAGAGG - Intergenic
1191962473 X:66718789-66718811 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1191969655 X:66799219-66799241 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1191972951 X:66838095-66838117 AGCCAAGTGGTCTTGATCAGTGG + Intergenic
1191987240 X:66995029-66995051 AGCCAAGTGGTCTGGCTCAGAGG - Intergenic
1192009241 X:67250402-67250424 AGCCAAGTGGTCTAGCTCAGCGG + Intergenic
1192018446 X:67357920-67357942 ATCCAAGTGGTCTTGCTCAGTGG + Intergenic
1192023877 X:67427311-67427333 AGCAAAGTGGTCTTGCTCAGTGG - Intergenic
1192064289 X:67864689-67864711 AGCCAAGAGGTCTAGCTCAGTGG - Intergenic
1192128993 X:68530418-68530440 AGCCAAGTGGTCTAGCTCAACGG - Intronic
1192228446 X:69246096-69246118 AGTCAAGTGGTCTTGCTCAGTGG + Intergenic
1192524535 X:71830153-71830175 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1192598538 X:72437529-72437551 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
1192674575 X:73182573-73182595 AGCCAAGTAGTCTAGCTCAGCGG + Intergenic
1192692111 X:73374873-73374895 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
1192707398 X:73541076-73541098 AGCCAAGTGGTCTCGTTCAGTGG + Intergenic
1192712628 X:73607434-73607456 AGCCAAGTGGTCTAGCTCAGTGG - Intronic
1192741010 X:73892719-73892741 AGCCAAGTTGTCTAGCTCAGCGG + Intergenic
1192755831 X:74046471-74046493 AGCCAAGTGGTGTAGCTCAGTGG - Intergenic
1192884284 X:75320504-75320526 AGGCAAGTGGTCTTGCTTAGTGG - Intergenic
1192953190 X:76039567-76039589 AGCCAAGTGGTCTCACTCAGCGG - Intergenic
1192974994 X:76273642-76273664 TACCAAGTGGTCTGGCTCTGTGG - Intergenic
1192994006 X:76492860-76492882 AGCCAAGTGGTCTTGCACAAAGG + Intergenic
1193010623 X:76671221-76671243 AGCCAAGGGGTCTAGCTCAGCGG + Intergenic
1193034461 X:76934414-76934436 AGCCAAGTGGTCTAGCTCAGCGG + Intergenic
1193065415 X:77254234-77254256 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
1193079330 X:77390392-77390414 AGCCAAGTGTTCTAGCTCAGTGG + Intergenic
1193081601 X:77411992-77412014 AGCCAAGTTGTCTAGCTCAGTGG - Intergenic
1193228441 X:79013382-79013404 AGCCAAGTGGTCCAGCTCAGTGG - Intergenic
1193334630 X:80273917-80273939 AGCCAAGTGGTCTAGCTCAATGG + Intergenic
1193382189 X:80828139-80828161 AGCCAAGTGGTCTCGCTCAGTGG - Intergenic
1193398556 X:81014361-81014383 AGCCAAGTGGTCTGGCTCGGCGG + Intergenic
1193404465 X:81084110-81084132 AGCCAAGTGGTCTCGCTCAGTGG + Intergenic
1193525303 X:82581287-82581309 AGCCAAGAGGTCTAGCTCAGTGG - Intergenic
1193547980 X:82852739-82852761 AGCCAAGTGGTCTAGCTCAGGGG - Intergenic
1193562647 X:83037979-83038001 AGCCAAGTGGTCTTGCTCAGCGG + Intergenic
1193645684 X:84066297-84066319 AGCCAAGTGGTCTTGCTCAGTGG + Intronic
1193829990 X:86278730-86278752 AGCCAAGTGGTCTAACTCAGTGG + Intronic
1193878720 X:86896041-86896063 AGCCAAGTGGTCTATCTCAGTGG + Intergenic
1194139846 X:90196147-90196169 ACCCCAGTGGTCTAGCTCAGCGG + Intergenic
1194158527 X:90422611-90422633 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1194254723 X:91622279-91622301 AGCCAAGTGGTCTGGCTCAGTGG - Intergenic
1194419909 X:93660896-93660918 AGCCAAGTGGTCTAGTTCAGTGG + Intergenic
1194515342 X:94845144-94845166 AGCCCAGTGGTCTAGCTCAGTGG - Intergenic
1194545132 X:95225154-95225176 AACCAAGTGGTCTTGCTCAGCGG + Intergenic
1194559528 X:95403587-95403609 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
1194771785 X:97915447-97915469 AGCCAAGTGGTCTAGCTCAGCGG + Intergenic
1194798411 X:98240791-98240813 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1194954431 X:100162527-100162549 AGCCAAGTGGTCTAACTCAGTGG - Intergenic
1194959083 X:100214725-100214747 AGCCAAGTGTTCTAGCTCAGCGG - Intergenic
1194961061 X:100236416-100236438 AGCCAAGTGGTCTAGCTCAGCGG - Intergenic
1195127450 X:101822480-101822502 AGCCAAGTGGTCTCACTCAGCGG - Intergenic
1195233034 X:102870133-102870155 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1195344968 X:103940611-103940633 GGCCAAGTGGTCTTGCTCAGCGG - Intronic
1195730293 X:107959881-107959903 AGCCAAGTGGTCTCTCTCAGCGG - Intergenic
1195820890 X:108944332-108944354 AGCCAAGTGGTATAGCTCAGCGG - Intergenic
1195833747 X:109089212-109089234 AGTCGAGTGGTCTTGCTTAATGG - Intergenic
1195842739 X:109192198-109192220 AGCCAAGTGGTCTGGCTCGGTGG + Intergenic
1195844257 X:109209243-109209265 AGCCAAGTGGTCTTGCTCAGTGG - Intergenic
1196133385 X:112181368-112181390 AGCCAAGTGGTCTAGCTCAGCGG + Intergenic
1196273177 X:113735952-113735974 AGCCAAGTGGTCTGACTCAGTGG - Intergenic
1196367829 X:114943165-114943187 AGACAAGTGGTCTAGCTCAGTGG - Intergenic
1196476461 X:116092143-116092165 AGCCAAGTGGTCTTGCTCAGCGG - Intergenic
1196587186 X:117443634-117443656 ACCCAAGTGGTCTGGCTCAGCGG + Intergenic
1196602966 X:117623040-117623062 AGCCGAGTGGTCCTGCTCAGTGG - Intergenic
1196960230 X:120993003-120993025 AGCCACGTGGTCTAGCTCAGCGG - Intergenic
1197051174 X:122061221-122061243 AGCCAAGTTGTCTTGCTCAGGGG + Intergenic
1197142179 X:123129828-123129850 AGCCGAGTTGTCTTGCCCAGAGG + Intergenic
1197319091 X:125006055-125006077 AGCCAAGCGGTCTTGCTCAGTGG + Intergenic
1197505989 X:127305993-127306015 AGTCAAGTGGTCTCGCTCAGCGG + Intergenic
1197847035 X:130813935-130813957 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
1197926920 X:131656421-131656443 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1198002290 X:132451622-132451644 AGCCAAGTGGTCTAGCTCAGCGG - Intronic
1198060584 X:133042161-133042183 AGCCAAGTGGTCTCACTCAGTGG - Intronic
1198085616 X:133279157-133279179 AGCAAAGTGGTCTAGCTCAGTGG + Intergenic
1198259237 X:134951268-134951290 AGCCAAGTGGTCTGGCTGAGCGG + Intergenic
1198555800 X:137792222-137792244 AGCCAAGTGTTCTAGCTCAGTGG + Intergenic
1198645513 X:138802033-138802055 AGCCAAGTGGTCTCACTCAGTGG - Intronic
1198758003 X:140001087-140001109 AGTAAAGTGGTCTTGCTCAGCGG + Intergenic
1198784494 X:140272851-140272873 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1199004134 X:142675322-142675344 AGCCAAGTGATCTTGCTCAGTGG - Intergenic
1199436587 X:147819561-147819583 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1199524909 X:148781651-148781673 AGCCAAGTGGTCTTGCTCAGTGG - Intronic
1199801199 X:151252905-151252927 AGCCAAGTGGTCTCACTCAGTGG + Intergenic
1199830669 X:151546244-151546266 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
1200333210 X:155319748-155319770 AGCCAAGTGGTCTAGCTCAGTGG + Intronic
1200365420 X:155657564-155657586 AGCCAAGTGGTCTCACTCAGCGG - Intronic
1200485592 Y:3765116-3765138 ACCCCAGTGGTCTAGCTCAGCGG + Intergenic
1200504843 Y:3999579-3999601 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1200573508 Y:4861882-4861904 AGCCAAGTGGTCTGGCTCAGTGG - Intergenic
1200732598 Y:6758589-6758611 AGCCAAGTGGTCTGGCTCAGCGG - Intergenic
1200740292 Y:6846783-6846805 AGCCATCTGGTCTTGCTCAGTGG - Intergenic
1201409148 Y:13681003-13681025 AGCCAAGTGGTCATGCTCAGGGG + Intergenic
1201608697 Y:15816304-15816326 AGCCAAGTGGTCTCACTCAGTGG + Intergenic
1201707127 Y:16949781-16949803 AGCCAAATGGTCTGGCTCAGTGG + Intergenic
1201850939 Y:18478951-18478973 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1201882380 Y:18841427-18841449 AGCCAAGTGGTCTAGCTCAGTGG + Intergenic
1201922176 Y:19245494-19245516 AGCCAAGTGGTCTTGCTCAGTGG + Intergenic
1201961937 Y:19690432-19690454 AGCCAAGTGGTCTAGCTCAGTGG - Intergenic
1202096308 Y:21251245-21251267 AGCCAAGTGGTCTTGCTCAGTGG - Intergenic
1202347901 Y:23954471-23954493 TGCCAAGTTATCTAGCTCAGTGG + Intergenic
1202522872 Y:25715633-25715655 TGCCAAGTTATCTAGCTCAGTGG - Intergenic