ID: 994016734

View in Genome Browser
Species Human (GRCh38)
Location 5:94975407-94975429
Sequence GAAGGCCTTTCCTCAGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 200}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994016734_994016735 -8 Left 994016734 5:94975407-94975429 CCATGCACTGAGGAAAGGCCTTC 0: 1
1: 0
2: 2
3: 20
4: 200
Right 994016735 5:94975422-94975444 AGGCCTTCTGAGCACACAGCAGG No data
994016734_994016739 15 Left 994016734 5:94975407-94975429 CCATGCACTGAGGAAAGGCCTTC 0: 1
1: 0
2: 2
3: 20
4: 200
Right 994016739 5:94975445-94975467 AAGGTGGCTGTCTACAAGCCAGG 0: 21
1: 87
2: 264
3: 555
4: 933
994016734_994016737 -4 Left 994016734 5:94975407-94975429 CCATGCACTGAGGAAAGGCCTTC 0: 1
1: 0
2: 2
3: 20
4: 200
Right 994016737 5:94975426-94975448 CTTCTGAGCACACAGCAGGAAGG 0: 1
1: 0
2: 11
3: 154
4: 984
994016734_994016741 22 Left 994016734 5:94975407-94975429 CCATGCACTGAGGAAAGGCCTTC 0: 1
1: 0
2: 2
3: 20
4: 200
Right 994016741 5:94975452-94975474 CTGTCTACAAGCCAGGAGGCAGG 0: 1
1: 3
2: 32
3: 109
4: 488
994016734_994016738 -1 Left 994016734 5:94975407-94975429 CCATGCACTGAGGAAAGGCCTTC 0: 1
1: 0
2: 2
3: 20
4: 200
Right 994016738 5:94975429-94975451 CTGAGCACACAGCAGGAAGGTGG No data
994016734_994016740 18 Left 994016734 5:94975407-94975429 CCATGCACTGAGGAAAGGCCTTC 0: 1
1: 0
2: 2
3: 20
4: 200
Right 994016740 5:94975448-94975470 GTGGCTGTCTACAAGCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994016734 Original CRISPR GAAGGCCTTTCCTCAGTGCA TGG (reversed) Intronic
900535523 1:3175269-3175291 GAAGGCCCTTCTTCAGTGGGAGG - Intronic
900637805 1:3674490-3674512 GAAGGCCTGTCCGCAGGGCCTGG - Intronic
901965032 1:12859495-12859517 GCCGGCCTTTACTCAGTGGAAGG + Intronic
902533710 1:17106839-17106861 CAAGATCTTTCCTCAGTCCATGG - Intronic
902699969 1:18165354-18165376 CATGGTCTTTCCTCTGTGCATGG + Intronic
903300011 1:22372049-22372071 GAAGGCCTACCCTCAGTGCCCGG - Intergenic
904626636 1:31809823-31809845 GATGGCCTTTCTCCAGGGCAGGG - Intronic
907273540 1:53304614-53304636 GAAGGTCTTACCTAACTGCAGGG - Intronic
907499591 1:54868586-54868608 GCATTCATTTCCTCAGTGCAAGG + Intronic
909155722 1:72073150-72073172 GAAGGCCTATCCTGACTCCATGG - Intronic
910872229 1:91845134-91845156 GGGGGCCTTTCCTGAGTTCAGGG + Intronic
913186493 1:116373967-116373989 GCGCGCCTTTCCTCAGGGCACGG - Exonic
914251005 1:145921302-145921324 GAAAGCTTTTCCTGACTGCACGG - Intergenic
915115785 1:153598669-153598691 GAAGGCCTTTCCTCCGTCTGGGG - Intergenic
915618142 1:157057873-157057895 GATTGCCTTTCCTCATTGAATGG + Intergenic
915841325 1:159215804-159215826 GCAGGGCTGTCCTCAGTGCATGG - Intergenic
916864841 1:168845396-168845418 GAAGCCCTTTCCTTATTGAAAGG + Intergenic
918319679 1:183352767-183352789 GAGGCCTTTTCCACAGTGCAGGG - Intronic
918378101 1:183929175-183929197 GAATGCCTTTCCTCCCTCCATGG - Intergenic
919137182 1:193524833-193524855 GAAGGCATTTTCTAAATGCAAGG - Intergenic
919318134 1:196000503-196000525 GAAGGCATTTCGTGAGTCCACGG - Intergenic
919847529 1:201650952-201650974 AAAGGCCCTGCCTCAGTGAATGG + Intronic
1063161993 10:3424829-3424851 AAATACCTTTCCTCAGTTCATGG - Intergenic
1064402112 10:15030123-15030145 GCAGGCCTTGGCTCAATGCAAGG + Intergenic
1065483121 10:26214075-26214097 GAAGGCCCTTCCTCAGATGAGGG - Intergenic
1065969658 10:30796270-30796292 GAGTCCCTTTCCCCAGTGCATGG - Intergenic
1066113969 10:32223291-32223313 GAAGGCCTTTCCTCCAAGGATGG + Intergenic
1066509084 10:36075462-36075484 GAAAGCCTTTTCACAGTTCAAGG + Intergenic
1073782304 10:106851457-106851479 AAAGACTTTTCCTCATTGCATGG + Intronic
1074540940 10:114364770-114364792 GAAGGATCTTGCTCAGTGCAGGG - Intronic
1075397848 10:122140905-122140927 GGAGGGCTTTACTCAGTGGAAGG + Intronic
1075502921 10:122994183-122994205 AAAGGCTTTTCATCAGGGCAGGG + Exonic
1076698433 10:132257956-132257978 GCAAGGCTCTCCTCAGTGCACGG + Intronic
1077055998 11:593465-593487 GAAGGCCTTTGCTCTGTGGCGGG + Intronic
1077237120 11:1487085-1487107 GAAGGCCTTTCCTGGGGGCTTGG - Intronic
1077250726 11:1559518-1559540 GGAGGCATTGCATCAGTGCAGGG - Intronic
1077419085 11:2441211-2441233 GAGGGGCTTTCCTCAGTGGAGGG + Intergenic
1082795322 11:57374750-57374772 AAAGGCCTGTCCTCAGTAGAGGG - Intergenic
1085129862 11:74028943-74028965 GCAGGCCCTCCTTCAGTGCAGGG - Intronic
1086285974 11:85252037-85252059 GAAGGAGTTTCCTCAGGCCAAGG + Intronic
1087230483 11:95655755-95655777 GAAGGTCTTTCCTCAGTAGTAGG + Intergenic
1087332429 11:96797823-96797845 CAAGGCCTTTCCTTGGTGCATGG + Intergenic
1087697815 11:101400868-101400890 GCAGTCCTTTCCTCATTGCTTGG - Intergenic
1087791341 11:102409448-102409470 AGAGGCCTTTCCTCATTGCACGG + Intronic
1088715571 11:112546329-112546351 GAAGGCCTTTCCATTGTTCAAGG + Intergenic
1089282564 11:117384687-117384709 GAAGGCATTTCCTAAGGGGATGG - Intronic
1091250436 11:134139773-134139795 GAAAACCTGACCTCAGTGCAAGG + Intronic
1093248407 12:16768957-16768979 GAATGGCTTGCCTCAGTGCTTGG + Intergenic
1094830198 12:34296653-34296675 AAAGGCCTTTCCTCCGTGTGAGG - Intergenic
1096139831 12:49233836-49233858 GAAAGCGTCTGCTCAGTGCAGGG + Intronic
1099279747 12:80629077-80629099 CATGGCCTTTCCTTGGTGCATGG + Intronic
1100856456 12:98761834-98761856 GAGGGCCTTTCCTCCCTGGATGG - Intronic
1101518579 12:105460339-105460361 GAAAGCCTTATCTCTGTGCATGG + Intergenic
1101561896 12:105864658-105864680 CATGGCCTTTCCTCTGTGCATGG + Intergenic
1102245407 12:111352777-111352799 GATGGCCTGTCCTCAGAGCTGGG + Intergenic
1104410036 12:128550257-128550279 GAGGGCCTTTCCTCTGTGCATGG + Intronic
1104487236 12:129162245-129162267 CAGGGTCTTTCCTCAGTGCATGG - Intronic
1105654361 13:22419983-22420005 GAAATACTTTCCTCAGTGAAAGG + Intergenic
1106676367 13:31963042-31963064 GAAAGCCTTCCATCTGTGCATGG - Intergenic
1107014361 13:35696550-35696572 GAAGCCCTTTCCTCAGCCCCAGG - Intergenic
1107295190 13:38900362-38900384 GAAGGTCTTTGCTGAGTCCAAGG - Intergenic
1108122871 13:47208574-47208596 TAAGTCCTTTCCTCATTGAAAGG - Intergenic
1108210057 13:48129137-48129159 GAGCTCCTTGCCTCAGTGCATGG - Intergenic
1108321151 13:49291758-49291780 GAAGGCCTGTCTACACTGCAGGG + Exonic
1111985752 13:95065244-95065266 GCAGCCATTACCTCAGTGCAAGG + Intronic
1121555177 14:94831050-94831072 CATGGCCTTTCTTCAGTGCAAGG + Intergenic
1122029062 14:98899472-98899494 GGAGGCATTTCCCCAGAGCATGG - Intergenic
1122695091 14:103548570-103548592 GAAGGCCCTGCCTCTGTGCCAGG + Intergenic
1125341888 15:38683542-38683564 CAAGGCCTTGCCTAACTGCAAGG + Intergenic
1127747048 15:61988975-61988997 AAAAGTCTTTCCTCATTGCAAGG - Intronic
1129903179 15:79167319-79167341 TATGGCCTTTCCTCTGTTCATGG + Intergenic
1131078641 15:89515293-89515315 GGAGGCCCTCCCTCAGGGCACGG + Intergenic
1132077304 15:98832607-98832629 GATTGCCTTTCTTGAGTGCATGG + Intronic
1132995060 16:2818426-2818448 GGAGGCCTTGGCTCAATGCAAGG + Intronic
1138032043 16:53567176-53567198 GAAGGCCACCCCTCAGAGCATGG - Intergenic
1138456623 16:57124852-57124874 GAGGGCCTGGCCTCTGTGCAGGG - Intronic
1139315892 16:66068364-66068386 GAATGCATTTCCTAGGTGCAGGG - Intergenic
1143031674 17:3971421-3971443 CAAGACCCTTCCTCAGGGCAGGG - Intergenic
1144077523 17:11732803-11732825 GAAGGCCTGGCCACAGGGCATGG - Intronic
1145748932 17:27341486-27341508 GCAGGCCTTTGCTCAGTGCCCGG + Intergenic
1146281607 17:31548904-31548926 GAAGCCCTTATCTCAGGGCAGGG - Intergenic
1146589491 17:34116431-34116453 TAAAGCCTTTACTCAGAGCAGGG - Intronic
1147492417 17:40882389-40882411 GAAGGCCATCCCTGAGTGCTGGG + Intronic
1147870182 17:43581733-43581755 GAAGACCTTTCCACTGTGCTGGG + Intergenic
1148211961 17:45813973-45813995 GAAGGCCTATCCTCAGTGGCTGG + Intronic
1150074512 17:62181036-62181058 CATGCCCTTTCTTCAGTGCATGG - Intergenic
1150896840 17:69221544-69221566 TAATGTCTTTCCTCAGTTCATGG - Intronic
1153090004 18:1332259-1332281 GAAGGCATTTTCTTAGTACAAGG - Intergenic
1156993935 18:43443730-43443752 GAAGGCAATTCTTCATTGCATGG - Intergenic
1162284009 19:9724358-9724380 GAAAGCCTTCACTCAGTACACGG - Intergenic
1164524646 19:29004413-29004435 AAAGGCCTTTTCTCAGTTCTGGG + Intergenic
1165327782 19:35124390-35124412 GGAGGCGTTTCCGCAGTTCATGG - Intergenic
1165596373 19:37013754-37013776 GAAGGCCATTGCTCCGTCCAAGG - Intronic
1166919917 19:46222143-46222165 GAAGCACATTCCTCAGGGCAGGG - Intergenic
926130128 2:10297768-10297790 CATGGCCTTTCCTTGGTGCATGG + Intergenic
927060497 2:19414155-19414177 CATGGTCTTTCCTCTGTGCACGG - Intergenic
927932973 2:27057475-27057497 GAAGGCCTTTCCAGACTGTAAGG - Intronic
927966563 2:27273667-27273689 GTAGGCCTGTGGTCAGTGCAGGG - Intronic
928353909 2:30590162-30590184 GAAGGCCTTTCCTAAGCAGAAGG - Intronic
928389311 2:30897166-30897188 GCAGGCCTTTTCTCAGAGAATGG - Intergenic
928768176 2:34672672-34672694 ACATTCCTTTCCTCAGTGCATGG + Intergenic
929117715 2:38458161-38458183 CAAGGCCTTTCCTCAGTTTTGGG + Intergenic
930741120 2:54833661-54833683 GAGGGCCATCCCTCAGTGAAAGG + Intronic
931970263 2:67577994-67578016 GAAGTCCTTTCCTGAGTGAATGG + Intergenic
933779901 2:85794442-85794464 GAAGGCCTTCTGTCAGTGCCTGG - Intergenic
934063952 2:88322207-88322229 GTAGTCCTTTCCTCCATGCAGGG - Intergenic
935845691 2:107163460-107163482 AAAGTCCTTTCCTCCCTGCATGG + Intergenic
936527603 2:113252270-113252292 CAAGGCCTTTCCTTTGTGGAAGG - Intronic
937506231 2:122540414-122540436 AAAGCGCTTACCTCAGTGCATGG - Intergenic
939152520 2:138489953-138489975 GAAGGTCTTGCCTCAGTGGTGGG - Intergenic
941184150 2:162300161-162300183 GAACGCAATTCCTCAGTGCTTGG + Intronic
945199836 2:207270485-207270507 TATGGCCTTTCCTCAGTGTGTGG - Intergenic
946253473 2:218427670-218427692 GCAGGCCTCTCCACAGGGCAGGG + Intronic
947252812 2:228126686-228126708 GATGGCCTTTCCCCAGAGCTAGG - Intronic
947860018 2:233352225-233352247 GAAGTCCTTGCCTCAGAGCAGGG + Intergenic
948314573 2:237017488-237017510 GAATTCCTTTCCCTAGTGCAAGG - Intergenic
1168761004 20:349416-349438 GAAGGCCTTAGCCCAGTGCCTGG - Intronic
1172935525 20:38617331-38617353 AAAGGCCTTTCCCAAGGGCAGGG - Intronic
1173889237 20:46492154-46492176 GAAAGCCTTTGCCCAGCGCATGG + Intergenic
1176028324 20:62997727-62997749 GACGGCCTGTCCTCAGTGTGGGG - Intergenic
1176268430 20:64222774-64222796 GAAGGCCTTGCTTCAGGGCCTGG + Intronic
1177759222 21:25383871-25383893 GAAGGGATTTCCACAGTGGAAGG + Intergenic
1178215626 21:30594406-30594428 GAAGTCCTTTCCCCATTGCTTGG + Intergenic
1178669302 21:34576990-34577012 GATGGCCTTTTCTCAGTAGAGGG - Intronic
1179181757 21:39051309-39051331 GAAGGCATTCCCTCTGTTCAGGG + Intergenic
1180232286 21:46434397-46434419 GAAGGCCTCAGCTCAGTGCTGGG + Intronic
1181942569 22:26489768-26489790 GAAGCCCCTCCATCAGTGCAGGG + Intronic
1182248293 22:28978471-28978493 GATGTCCACTCCTCAGTGCAGGG + Intronic
1182278821 22:29206442-29206464 ATAGGCCTTTCCCAAGTGCAGGG - Intronic
1182332330 22:29560048-29560070 GAAGGCCTTTCCCCACCACAGGG + Intronic
1184415032 22:44347330-44347352 GGAGGCCCTTCCTCCGCGCAGGG + Intergenic
1185088456 22:48753132-48753154 GACCTCCTTCCCTCAGTGCATGG - Intronic
1185124240 22:48996960-48996982 GAATGCCCTTCCTCAATGAATGG - Intergenic
949566730 3:5252116-5252138 GAAGGCCTTGGCCCAGTGCCTGG + Intergenic
950869152 3:16213781-16213803 GAAGGACATGCCTGAGTGCAGGG + Intronic
951648681 3:24923629-24923651 GAAGCCCTTTGCTTAGGGCAAGG + Intergenic
952947723 3:38490808-38490830 GAAGCCCTTTCTTCAGTCCTTGG - Exonic
954005647 3:47588391-47588413 GAAGTCCTTTCCTTAGTGGCAGG + Intronic
954751644 3:52817417-52817439 GAATGTCTTTCCTGAGGGCAGGG - Intronic
955621786 3:60872193-60872215 GAAAGCATTTCCTCATAGCATGG - Intronic
958255972 3:91325252-91325274 GAAGGCCTTTCTTTTGTGAAGGG - Intergenic
958573622 3:95918711-95918733 CATGGCCTTTCCTCTGAGCATGG - Intergenic
960520541 3:118649519-118649541 TAAGGCCTTACCACAATGCATGG - Intergenic
961634025 3:128321668-128321690 GAAGGCCCTTCCTGGGTGGAAGG - Intronic
962310929 3:134326372-134326394 GAATGCCATTCCTCATTCCAGGG + Intergenic
963462364 3:145633079-145633101 GAAGGATTTTCCCCAGTCCAGGG + Intergenic
964738909 3:159944780-159944802 GAAGGATTTTCCACAGTGCTGGG - Intergenic
968059413 3:195715891-195715913 GAGGGCCTGTCCTCAGGGCCTGG + Intergenic
968251479 3:197219830-197219852 CAAGGCCTTTCCTCTGTGCATGG - Intronic
968380023 4:85751-85773 CAAGACCTTTCACCAGTGCAGGG + Exonic
968564910 4:1306620-1306642 GAAGGCCTTCTCCCAGTCCATGG + Intronic
972324109 4:37998954-37998976 GAAGGCTTTTCCACTGGGCACGG + Intronic
975489890 4:74976557-74976579 GGAGGACTTCCCCCAGTGCAGGG + Intronic
978372564 4:108043635-108043657 GATGATCTTTCCTCAGTGCCTGG - Intergenic
978394639 4:108265640-108265662 GAAGGCTTTTGTTCAGTACAGGG - Intergenic
978503781 4:109434788-109434810 GAAGGCCCTGCCTCAAAGCAGGG - Intronic
985349371 4:189040923-189040945 CAAGATCTTTCCTCTGTGCAAGG + Intergenic
985694084 5:1330212-1330234 GAAAGCCTTTCCTGAGTGCGTGG + Intronic
990943965 5:61230841-61230863 CATGGCCTTTCCTTGGTGCATGG - Intergenic
994016734 5:94975407-94975429 GAAGGCCTTTCCTCAGTGCATGG - Intronic
994323025 5:98414974-98414996 CATGGCCTTTCCTCTCTGCATGG - Intergenic
994904175 5:105815246-105815268 GAAGTTCTTTCATAAGTGCAGGG - Intergenic
995322464 5:110851911-110851933 CATGGCCTTCCCTCTGTGCATGG - Intergenic
996112525 5:119582473-119582495 GGAAGCCTTCCCTCAGTGTATGG + Intronic
997336267 5:133110919-133110941 GAAGGTCTTTCCTCTGTGACTGG + Intergenic
999596316 5:153208958-153208980 GAAGGCCTTTCCTGAGGACAGGG - Intergenic
1000444363 5:161301709-161301731 GCAGGCCTTGCTTCAGTACAAGG + Intronic
1000966530 5:167664248-167664270 GCAGGCCTATCCTCAGGCCAAGG - Intronic
1001015737 5:168139555-168139577 GCAGGCCTTTCCTCTGTGAGGGG + Intronic
1001580684 5:172796243-172796265 GAAGGCCTTGGCACAGTGCTGGG + Intergenic
1002079772 5:176730459-176730481 GCAGCCCTTTCCTGAATGCAGGG - Intergenic
1003047692 6:2749210-2749232 AATGGCCTTTTTTCAGTGCAGGG - Exonic
1003975670 6:11341432-11341454 GAAGCCCCTCCCTCAGTCCACGG + Intronic
1004240453 6:13916527-13916549 GACAGCCTTTCCTCAGGGCTGGG + Intergenic
1005740668 6:28787596-28787618 TAAGGCCTTTCCTTAGAGCTTGG - Intergenic
1005870884 6:29974096-29974118 GAAGGCCCTTCCTCAGGCCTTGG - Intergenic
1006213136 6:32414429-32414451 GGAGGCCTTTCCTCACAGCGTGG + Intergenic
1006690212 6:35877188-35877210 GAAGGTCTTGCCTCAGTAGAGGG + Intronic
1009039854 6:58162960-58162982 TATGGCCTTTCCTCTGTGCATGG + Intergenic
1009215745 6:60917808-60917830 CATGGCCTTTTCTCTGTGCATGG + Intergenic
1010695227 6:78965014-78965036 AACGTCCTTTTCTCAGTGCAAGG + Intronic
1014125323 6:117770288-117770310 CATGGCCTTTCCTTGGTGCATGG + Intergenic
1014740724 6:125145101-125145123 GAAGGCATTCCTTCAGTGTAGGG + Intronic
1014789115 6:125651734-125651756 GTATGCCTTTCCTAAGAGCAAGG + Intergenic
1015140512 6:129925913-129925935 AAAGGCATTACCTCAGTACAAGG - Intergenic
1015970681 6:138740257-138740279 AAATGCCTTTCCCCAGTGTACGG - Intergenic
1017866342 6:158446799-158446821 CATGGCCTTTCCTCAGTGCTTGG + Intronic
1018245921 6:161823745-161823767 GAAAAACCTTCCTCAGTGCACGG - Intronic
1019214931 6:170437432-170437454 GAAGGCCTCTCCACAGGGCAGGG + Intergenic
1020148734 7:5665332-5665354 GAAGCCCTTTCCTCAGGACTAGG - Intronic
1020438551 7:8192407-8192429 TCCGGCTTTTCCTCAGTGCATGG + Intronic
1020440676 7:8213491-8213513 GAAGGCCTTTCCTTTCTGCCTGG - Intronic
1021635240 7:22685380-22685402 GAAGACTTTTCCTCATTACATGG - Intergenic
1023569132 7:41554279-41554301 GAAGTCCTTTCCCAATTGCAGGG + Intergenic
1024424073 7:49205401-49205423 AAAGGCCTTTACCCAGTGCTTGG + Intergenic
1024791326 7:52967852-52967874 CATGGCCTTTCCTCCTTGCACGG + Intergenic
1029907033 7:104102584-104102606 CAAAAACTTTCCTCAGTGCAAGG - Intergenic
1032071248 7:128808629-128808651 GAAGGCCTTTCCCCAGGGACAGG - Intronic
1032228068 7:130050036-130050058 GAAGGCATTTCAACAGTGCCTGG + Intronic
1035281314 7:157780217-157780239 CAAGGACGTTCCTCAGAGCAAGG + Intronic
1036570954 8:9979572-9979594 GAAGGCCTCTCTTCAGGGAAGGG - Intergenic
1036729197 8:11246964-11246986 AAAGGACTTAGCTCAGTGCATGG + Intergenic
1037588530 8:20294663-20294685 AAGGGCATTTCCACAGTGCAAGG - Intronic
1038159915 8:25026770-25026792 CACGGCCTTTCCACAGTGCATGG + Intergenic
1050276666 9:4008034-4008056 TAAGGCCTTTCTTCAGGCCAGGG - Intronic
1052095344 9:24377161-24377183 GAAGACATGTCCTCAGTGCCTGG - Intergenic
1057320725 9:94010311-94010333 CATGGCCTTTCCTTGGTGCATGG + Intergenic
1058566779 9:106294202-106294224 TAAGCTCTTTCATCAGTGCAAGG + Intergenic
1059171285 9:112127493-112127515 GAAGGACTTTGCTCAGTGTGAGG - Intronic
1060881435 9:127120941-127120963 GAAGGCCTTGGCTTAGTGCCTGG - Intronic
1061049607 9:128186639-128186661 AAAGGCCATTCCTCACTGCATGG + Intronic
1061262026 9:129485638-129485660 GCGGGCCCTTCCTCAGAGCATGG - Intergenic
1061650282 9:132042267-132042289 GAAAGCCTTTTCTCCGTGCCTGG - Intronic
1062716269 9:138011746-138011768 GAAGGTCTCTCCTCTGTGGAGGG + Intronic
1186603047 X:11058787-11058809 TGAGGACTTTCCTAAGTGCAAGG + Intergenic
1186828403 X:13364938-13364960 GAAACCCGTTCCTCAGTTCATGG - Intergenic
1187441450 X:19324277-19324299 GAAGGCCTTTCCTAACTCCGAGG - Intergenic
1188108003 X:26165662-26165684 GAAGGCATCTCCTCATAGCAAGG - Intergenic
1188111398 X:26198919-26198941 GAAGGCATCTCCTCATAGCAAGG - Intergenic
1189842459 X:45095155-45095177 GAAGCACTTTGCTCAGTGCTTGG - Intronic
1196282092 X:113833675-113833697 GAAGGCCTTCTATCAGTGTAGGG - Intergenic
1199502322 X:148521031-148521053 GAAAGCCATTTATCAGTGCATGG + Intronic
1200770377 Y:7119640-7119662 GTAGGTCTTTCCTCAGTGGATGG + Intergenic