ID: 994016738

View in Genome Browser
Species Human (GRCh38)
Location 5:94975429-94975451
Sequence CTGAGCACACAGCAGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994016734_994016738 -1 Left 994016734 5:94975407-94975429 CCATGCACTGAGGAAAGGCCTTC 0: 1
1: 0
2: 2
3: 20
4: 200
Right 994016738 5:94975429-94975451 CTGAGCACACAGCAGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994016738 Original CRISPR CTGAGCACACAGCAGGAAGG TGG Intronic
No off target data available for this crispr