ID: 994017913

View in Genome Browser
Species Human (GRCh38)
Location 5:94989894-94989916
Sequence TGTCACAGCCAGAGAGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 1, 1: 1, 2: 7, 3: 77, 4: 472}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994017913 Original CRISPR TGTCACAGCCAGAGAGGGCA TGG Intronic
900295396 1:1946692-1946714 TGTCCCAGCCAGGGAGGCCGCGG + Intronic
900566551 1:3335034-3335056 GGGCACAGCCAGAGAGGACGGGG + Intronic
900606568 1:3526214-3526236 TGCCCCGGCCAGAGAGGCCAAGG + Intronic
900694708 1:4002529-4002551 TGGCACGGTCAGAGAGGCCAGGG - Intergenic
900963279 1:5939577-5939599 TGTGAGACCCAGTGAGGGCAGGG - Intronic
901170044 1:7250311-7250333 TGTCACAGCCGTAGAGGGGGAGG + Intronic
902290216 1:15430408-15430430 TGTCAGAGCCTGGGAGGGAAGGG + Intergenic
903526545 1:23995195-23995217 TGGCACAACCAGGGAGGCCATGG + Intergenic
903866230 1:26400311-26400333 TTTGAAAGCCAGAGTGGGCAGGG - Intergenic
903941817 1:26937188-26937210 TGGCACACCCAGAGAGGGTACGG - Intronic
905203048 1:36326698-36326720 TGTCCAAGCCAGTGAGGGCGGGG + Intronic
905412092 1:37777718-37777740 TGGCATCCCCAGAGAGGGCATGG - Intergenic
906279166 1:44541953-44541975 TGTCACAGCGAGAGATGCAAAGG - Intronic
908560518 1:65301651-65301673 TGGTGCACCCAGAGAGGGCATGG - Intronic
910690387 1:89959674-89959696 TGGCACATCCAGAGAGGGTATGG - Intergenic
910881352 1:91924858-91924880 TGGCGCACCCAGGGAGGGCATGG - Intergenic
911120725 1:94293748-94293770 TGGCACACCCATGGAGGGCATGG - Intergenic
911890956 1:103371263-103371285 TGGCACACCCAGGGAGGGCATGG + Intergenic
912651192 1:111441158-111441180 TCTCACAAGCTGAGAGGGCAGGG + Exonic
912731144 1:112106699-112106721 TAGCACACCCAGAGAGTGCATGG - Intergenic
912925751 1:113911592-113911614 TCTAACAGCCAGAGAAGGCTTGG - Exonic
912972556 1:114297703-114297725 GGTCACAGCCAGTAAAGGCAGGG - Intergenic
914044887 1:144083084-144083106 GGTAACAGCCAGAGAGGACCTGG - Intergenic
914133223 1:144877602-144877624 GGTAACAGCCAGAGAGGACCTGG + Intergenic
914929781 1:151920837-151920859 TGGCATGCCCAGAGAGGGCATGG - Intergenic
916533774 1:165683389-165683411 TTTCAGAGCCTCAGAGGGCATGG - Intronic
917443579 1:175088004-175088026 TGGCACACCCACAGAGGCCATGG - Intronic
917470588 1:175322951-175322973 TGTCACAGCCTGACATGGCCAGG - Exonic
918340207 1:183562426-183562448 TGTCTCAGCCAGAGACACCAGGG + Intronic
919589928 1:199488775-199488797 TGTCACAACTAGAGAGGGAGAGG - Intergenic
919835520 1:201570538-201570560 TGAAACAACCAGAGAGGCCAAGG + Intergenic
920720145 1:208379706-208379728 TGGCACACCCAGGGAGGGCATGG + Intergenic
921703605 1:218294576-218294598 CGGCACACCCAGGGAGGGCATGG - Intronic
922006374 1:221534683-221534705 TGGCTCACCCAGAGAGGGCATGG - Intergenic
922599441 1:226838476-226838498 TGGCACATTCAGGGAGGGCATGG - Intergenic
922791408 1:228313210-228313232 TGGCACGCCCAGAGAGGACATGG - Intronic
923385259 1:233459836-233459858 GGTCAGAGGCAGAGGGGGCAGGG - Intergenic
1063364084 10:5479394-5479416 TCTCAGAGCCAGAGAGGCCCAGG - Intergenic
1064901642 10:20301886-20301908 TGGAGCACCCAGAGAGGGCATGG - Intergenic
1065250914 10:23812656-23812678 TGTCACAGCCAGTGGGCACAGGG - Intronic
1065990639 10:31006431-31006453 TGGTACACCCAGGGAGGGCAAGG + Intronic
1066957013 10:42182766-42182788 GGTAACAGCCAGAGAGGACCTGG - Intergenic
1069069472 10:63978472-63978494 TGTTACAGTCAGAGGGGACAAGG + Intergenic
1069821224 10:71229856-71229878 TGGGACAGCCAGAGATGGCATGG - Intronic
1069840964 10:71339179-71339201 TACCACAGCCAGTGAGGGCGAGG - Intronic
1070312334 10:75282901-75282923 TGTGACTCCCAGAGAGGGAAGGG - Intergenic
1070764891 10:79050702-79050724 TGGCACTCCAAGAGAGGGCATGG - Intergenic
1070792417 10:79197200-79197222 TTTCACAGCCAGCCAGGACAGGG - Intronic
1070987474 10:80700965-80700987 GGTCCCACACAGAGAGGGCAGGG + Intergenic
1071329574 10:84546406-84546428 AGTGACAGCCAGACTGGGCAGGG + Intergenic
1073492189 10:103860020-103860042 TTGCACAGCCAAAGAGGCCAAGG + Intergenic
1073947921 10:108773544-108773566 TGGCATAGCCAGAGAGAGCATGG - Intergenic
1075184540 10:120243872-120243894 TGGCACCCCCAGAGAGGGCATGG - Intergenic
1076384538 10:130046864-130046886 TGTCACCCCCAGAAAGGTCAGGG - Intergenic
1076658415 10:132039371-132039393 TGTCAAAACCGGAGGGGGCAAGG - Intergenic
1076694435 10:132240333-132240355 TGTCACAGTCACACATGGCAGGG + Intronic
1077304721 11:1863971-1863993 TGTCACCTCCAGAGAAGGCTTGG - Intronic
1077374138 11:2197665-2197687 TGACACTGCCAGGCAGGGCAGGG + Intergenic
1077642621 11:3895186-3895208 GGTCACAGGCAAACAGGGCAGGG + Intronic
1077661182 11:4070008-4070030 AGTCACTGCCAGAGAGGGGAGGG - Exonic
1077995203 11:7446802-7446824 GCTCACAGACAGAAAGGGCAGGG - Intronic
1078039782 11:7849251-7849273 TGTCAGAGCAGGAGAGGGCCAGG - Intergenic
1078140728 11:8690841-8690863 TGTCACAGTCATGGAGGGGAAGG + Intronic
1078328469 11:10399104-10399126 TGGTGCATCCAGAGAGGGCATGG - Intronic
1079227711 11:18622001-18622023 TGTCTCAGCCAGGGAGGTCGAGG + Intronic
1079366372 11:19813718-19813740 AGACACTCCCAGAGAGGGCATGG + Intronic
1079695269 11:23474596-23474618 TGGCACACTCGGAGAGGGCATGG + Intergenic
1079835298 11:25326574-25326596 TGGTACACCCAGGGAGGGCATGG + Intergenic
1082884652 11:58069336-58069358 TGTCACAGGCAGAGAGGAAGGGG - Intronic
1082986985 11:59177571-59177593 TGTTAGAGCCAGAGAGGGTATGG - Intronic
1083143136 11:60738043-60738065 TGTCAGAGCAAGAGAGGACTAGG - Intronic
1083406021 11:62457768-62457790 TGTCACCACCAGAGAGAGGAGGG + Intronic
1083418393 11:62539806-62539828 GGCCACAGCCAGAGCAGGCAGGG - Intronic
1083699687 11:64467736-64467758 TGGTATGGCCAGAGAGGGCATGG + Intergenic
1084381940 11:68818143-68818165 TGTCACTGACAGAGTGGGCCAGG - Intronic
1084427992 11:69096040-69096062 TGTCTCCGCCAGGAAGGGCAGGG - Intergenic
1084464141 11:69312533-69312555 AGTCAGAGCCAGAGAAGGCAGGG + Intronic
1084490351 11:69475125-69475147 TGGCACAGCCAGAGGTGGCCAGG + Intergenic
1084567619 11:69940348-69940370 AGGCACAGCCAGGGAGGGGATGG - Intergenic
1084971027 11:72772135-72772157 TGGCACTGCCATAGTGGGCATGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1084993772 11:72955380-72955402 TAGCCCACCCAGAGAGGGCATGG - Intronic
1085281866 11:75336241-75336263 AGACACATCCAGAGAGGGCACGG - Intronic
1085355451 11:75832527-75832549 TGGCACACCCAGAGAGGGCATGG - Intronic
1085475690 11:76787454-76787476 TCACACAGCCAGAGAGGACAGGG - Intronic
1086055186 11:82638435-82638457 TGTCAAAGCTGGAGAAGGCAAGG - Intergenic
1087170439 11:95044356-95044378 TGTCTCGGGCAGAGAGGGGAAGG + Intergenic
1088435000 11:109802472-109802494 TGGCACTGCTAGAGAGAGCATGG - Intergenic
1088921805 11:114264880-114264902 TGGCACACCCAGGGAGGGTATGG - Intronic
1090289414 11:125528768-125528790 TGCCATACCCAGAGAGGGCATGG + Intergenic
1090409578 11:126498610-126498632 TGTCACAGCCAGGAGGGGAAGGG + Intronic
1090596935 11:128330132-128330154 TGTGGCAGTCAGAGAGGGGATGG - Intergenic
1091043374 11:132303290-132303312 TGTCACTGTCAGAGAGAGCATGG - Intronic
1091389562 12:117779-117801 TCTTACAGCCAGCGAGGTCAGGG + Intronic
1091603972 12:1934995-1935017 GGTCACAGTCAGACAGGGCAGGG + Intergenic
1092957864 12:13566122-13566144 ACTCACAGCCAGAAAGGACACGG + Intronic
1093118151 12:15236040-15236062 TGTGACAGCTGGAGACGGCAAGG - Intronic
1093254534 12:16850587-16850609 TGGCACACCAAGAGAGGGCATGG - Intergenic
1093393443 12:18651579-18651601 AGTCACAACTAGAGAAGGCAGGG - Intergenic
1093923898 12:24889984-24890006 TGGCACACCCCGGGAGGGCATGG + Intronic
1094601491 12:31912735-31912757 TGGCGCACCTAGAGAGGGCAAGG - Intergenic
1095426084 12:42075998-42076020 TGACAAAGTGAGAGAGGGCAAGG + Intergenic
1096618202 12:52846531-52846553 TGTCACTGCAGGAGAGGGCGGGG - Intronic
1096983551 12:55742873-55742895 AGTCAGAGCCAGAGAGACCAAGG - Intergenic
1099016261 12:77347597-77347619 TGGCACATCCATGGAGGGCATGG - Intergenic
1099103433 12:78471639-78471661 TGGCATGCCCAGAGAGGGCATGG + Intergenic
1100040340 12:90309919-90309941 TGGTGCACCCAGAGAGGGCATGG - Intergenic
1100256040 12:92884310-92884332 TGTCAAAGCAAGAGATGGCTAGG + Intronic
1100411793 12:94326187-94326209 TGGCTCACACAGAGAGGGCATGG + Intronic
1100857192 12:98767909-98767931 TGGGACTGCCAGAGAGGGAATGG - Intronic
1101395315 12:104342023-104342045 TGCCACACCTAGAGAGGACATGG - Intronic
1101772845 12:107767451-107767473 TGGCACGCCCAGGGAGGGCATGG - Intergenic
1102082199 12:110107550-110107572 TGTCACAGCCATGTAGTGCACGG + Intergenic
1102304119 12:111791816-111791838 TGCCAGAGCCTGAGAGGTCAAGG + Intronic
1102953854 12:117046946-117046968 TGCCAAAGCCAGAGGGGTCAGGG + Intronic
1103900779 12:124302753-124302775 TCTCACCGCCAGGGAGGTCAGGG + Intronic
1104902619 12:132197572-132197594 TCACACAGCCAGAGAGGGGTCGG - Intronic
1104999490 12:132680528-132680550 TGTGACTGTCAGGGAGGGCATGG - Intronic
1105239298 13:18595982-18596004 TCTCCCCACCAGAGAGGGCAGGG + Intergenic
1106114898 13:26809044-26809066 TGACACACCCAGAGAGGAAAAGG - Intergenic
1106283065 13:28294574-28294596 TGTGAAAGCTAAAGAGGGCAGGG + Intronic
1106350460 13:28924640-28924662 TCACACAGCCAGAGAGGAAAGGG - Intronic
1107018811 13:35731039-35731061 TGGCACACCCAGAGGGGGCTTGG - Intergenic
1107555074 13:41510414-41510436 TGGCGCATCCAGAGAGGGTATGG - Intergenic
1109332016 13:60942007-60942029 TGGCATGCCCAGAGAGGGCATGG - Intergenic
1109498537 13:63208447-63208469 TGTCACAGCAAGAAGGTGCAAGG - Intergenic
1110220776 13:73070622-73070644 TGCCAAACCCAGAGAGGGAATGG - Intronic
1110488408 13:76073130-76073152 TGGCACGTCCAGAGGGGGCATGG + Intergenic
1111768027 13:92559540-92559562 TGTAAGAGCCAGATAGGGGAGGG - Intronic
1112239087 13:97663467-97663489 TGTTAAAGACAGAGAAGGCAGGG - Intergenic
1112321908 13:98415576-98415598 TGTCACATCCAGGGTGGTCATGG + Intronic
1113460682 13:110479896-110479918 TGCCCCAGCCAGAGCTGGCAAGG + Intronic
1113544980 13:111141464-111141486 GGGCACACCCAGGGAGGGCATGG - Intronic
1114064667 14:19051057-19051079 TCTCCCCACCAGAGAGGGCAGGG + Intergenic
1114097594 14:19348945-19348967 TCTCCCCACCAGAGAGGGCAGGG - Intergenic
1114356828 14:21919112-21919134 TGGCAGAGCCAGAGAAGGCATGG - Intergenic
1116164844 14:41322475-41322497 TGACACAACCAGGGAGGGCATGG + Intergenic
1116384176 14:44310477-44310499 TGGCACACCCAGAGAGGGTGTGG + Intergenic
1117229449 14:53700700-53700722 TGGCACACCTGGAGAGGGCATGG + Intergenic
1117981702 14:61348203-61348225 TGTCACAGCCAGAGAGCAGGGGG + Intronic
1117982565 14:61356489-61356511 TGTCAAAGCCAGAGATAGCCCGG - Intronic
1118141915 14:63093215-63093237 TATCACACCCAGGGAGGGCATGG + Intronic
1119898740 14:78242646-78242668 TGCCCCAGCCAGGGAGGCCAGGG - Intronic
1120969287 14:90193856-90193878 GGAAACAGCCAGAGAGGGCAGGG + Intergenic
1121346119 14:93136930-93136952 TGTCACACCCACTGAGCGCAAGG - Intergenic
1121423784 14:93833848-93833870 TGTGACAGACAGACAGGGCATGG - Intergenic
1121468908 14:94136765-94136787 TGGCAGAGACAGAGAGGACAGGG - Intergenic
1121638807 14:95471803-95471825 TGTCGCAGCCAATGAGGGCAAGG + Intronic
1122252448 14:100449458-100449480 TGCAACAGCCAGCCAGGGCAGGG - Intronic
1122866401 14:104606546-104606568 TTTCTCAGCCAGCGAGGGGAGGG - Intergenic
1122944248 14:104998687-104998709 CGTCTCAGCCTGGGAGGGCAGGG - Intronic
1122967932 14:105139912-105139934 TGGCACAGCCAGAAAGGGCCAGG + Intergenic
1202936098 14_KI270725v1_random:89010-89032 GGTAACAGCCAGAGAGGACCTGG + Intergenic
1123403145 15:20005426-20005448 TGTCAGAGCCAGGCAGGCCAGGG + Intergenic
1123512484 15:21012080-21012102 TGTCAGAGCCAGGCAGGCCAGGG + Intergenic
1125578436 15:40770006-40770028 AGCCACTGGCAGAGAGGGCACGG + Intronic
1126111200 15:45175670-45175692 TGCAACAGCCAGCGAGGGCTGGG + Intronic
1126313113 15:47339122-47339144 CGGCACACCCAGAGAGAGCATGG + Intronic
1126596899 15:50392127-50392149 TGGCACACGCAGAGAGGGCATGG + Intergenic
1127691253 15:61399573-61399595 ACACACAACCAGAGAGGGCAGGG + Intergenic
1128345111 15:66848571-66848593 AGCCACAGCCAGAGAAGGGAAGG + Intergenic
1128631519 15:69273206-69273228 AGTCATGGCCAGAGAAGGCAGGG - Intergenic
1128801125 15:70497820-70497842 TGTTAAAGCCAGGCAGGGCAGGG - Intergenic
1128987897 15:72234622-72234644 TGCCACTCCCAGGGAGGGCATGG + Intergenic
1129034392 15:72640787-72640809 ACTCAGAGCCAGAGAGGGCCAGG - Intergenic
1129215490 15:74096429-74096451 ACTCAGAGCCAGAGAGGGCCAGG + Intergenic
1129732634 15:77940758-77940780 ACTCACAGCCAGAGAGGGCCAGG + Intergenic
1130513665 15:84609163-84609185 TGTCTCAGCCAGAAAGGGAGTGG + Intronic
1130832433 15:87615389-87615411 CTTCACACCCAGAGAAGGCAGGG - Intergenic
1132182615 15:99770470-99770492 TGTAAGAGCCAGATAGGGGAGGG + Intergenic
1132425065 15:101709266-101709288 TTCCATAGCCAGTGAGGGCAGGG - Intronic
1132828168 16:1915105-1915127 TGCCAAAGCCAGAAAGTGCAGGG + Intronic
1133019817 16:2962509-2962531 TGTCTCCTCCAGAGGGGGCAGGG - Intergenic
1133234646 16:4382198-4382220 TGTGAGAGCCAGATGGGGCAGGG + Exonic
1133741156 16:8652503-8652525 TTTCACAGCAAGCAAGGGCAAGG - Intergenic
1134109105 16:11503594-11503616 TGTCACAGCCACACACAGCAGGG - Intronic
1134286551 16:12867034-12867056 TGTCTGAGAAAGAGAGGGCAAGG + Intergenic
1135017005 16:18931951-18931973 TGTCACAGGCAGAGACAGAAGGG + Intergenic
1135072284 16:19362605-19362627 TGGTGCACCCAGAGAGGGCATGG - Intergenic
1135082987 16:19452288-19452310 TGGCTCACCCAGGGAGGGCATGG - Intronic
1135722569 16:24829775-24829797 TGTCTGAGACAGAGTGGGCAAGG + Intergenic
1137055568 16:35745026-35745048 TGTCTCTGCCAGAAAGGGAAAGG + Intergenic
1137918133 16:52455373-52455395 TGTCACAGCCCGGTAGGGAAAGG - Intronic
1138770729 16:59660637-59660659 TCTCAAAGCTAGAAAGGGCAAGG - Intergenic
1138906489 16:61341064-61341086 TGTCAGATCCAGGGAGAGCAAGG - Intergenic
1141184809 16:81779525-81779547 TGGCTCAGCCGGAGCGGGCAGGG + Intronic
1141670367 16:85488552-85488574 GCTCACAGCCAGACAGGGAAGGG + Intergenic
1141724776 16:85780559-85780581 TGCCCCAGCCAGCGTGGGCACGG - Intronic
1141732620 16:85833162-85833184 TGTCATACCCAAACAGGGCAAGG - Intergenic
1142102994 16:88285478-88285500 TGCCACAGCCAGCGTGGGCAGGG + Intergenic
1142139774 16:88467720-88467742 GGTCCCAGCCACAAAGGGCACGG - Intronic
1142266776 16:89067600-89067622 TAACACAGCCAGTGAGGACATGG + Intergenic
1142985272 17:3691444-3691466 CGGCACAGTCAAAGAGGGCAGGG + Intronic
1143506490 17:7368609-7368631 TGTCATGCCCAGAGAGGGCACGG + Intergenic
1144217459 17:13068915-13068937 TGGCACACCAAGAAAGGGCATGG - Intergenic
1144335547 17:14266001-14266023 TGTCACGCCCAAAGAGGGCAAGG - Intergenic
1145104384 17:20103233-20103255 TTTCTCAGGCAGAGAGGGCAGGG - Intronic
1145287163 17:21514420-21514442 TCTCACAGCCACAGAGATCAAGG - Intergenic
1145390461 17:22451931-22451953 TCTCACAGCCACAGAGATCAAGG + Intergenic
1145811766 17:27768631-27768653 TCTCACAGCCATAGAGAGCCTGG - Intronic
1146507649 17:33419140-33419162 TGTCTCTGCCAGACAAGGCATGG - Intronic
1147738298 17:42654900-42654922 TGGAGCACCCAGAGAGGGCATGG + Intergenic
1148438361 17:47699031-47699053 AGTCACAGCCAGAGACGGGGCGG - Intronic
1148803736 17:50252357-50252379 TTTCACAGCTAGAGAGGAGAAGG - Intergenic
1149118451 17:53129916-53129938 TGACACAGCGAGAGATGGCATGG - Intergenic
1149358183 17:55866007-55866029 TTTCACAGGTAGTGAGGGCAGGG - Intergenic
1150725729 17:67649925-67649947 TGGCACACCCAGAGGGGGCACGG - Intronic
1151904107 17:77036400-77036422 TGGCACGTCCAGAGAGGGCAGGG - Intergenic
1152087597 17:78230211-78230233 TTTCAGAGACAGGGAGGGCAGGG - Intergenic
1152863813 17:82710566-82710588 TTTCAAAGCCAGAGCAGGCACGG + Intergenic
1152980925 18:275686-275708 TGTTACAGCCAGAGCTGGCCTGG + Intergenic
1153754239 18:8263789-8263811 TGGCACATCCACAGAGGGCATGG + Intronic
1154365847 18:13708300-13708322 TGGCACACCCAGAGAGGGCATGG - Intronic
1154449495 18:14462655-14462677 TCTCCCCACCAGAGAGGGCAGGG - Intergenic
1155293705 18:24366225-24366247 GATCACACCCAGGGAGGGCATGG - Intronic
1155537406 18:26831732-26831754 TGCCAGAGCCGGAGAAGGCACGG + Intergenic
1155791042 18:29971324-29971346 TGGCACAGCCAGAAAGGAGATGG + Intergenic
1156220165 18:35042954-35042976 TGTAACTGCCAGAGATGACAGGG - Intronic
1156264409 18:35473368-35473390 TGTCACAGGCAGAGAGAGTTTGG - Intronic
1156333462 18:36147937-36147959 CGGCACAGCCAGGGAGGGCATGG - Intronic
1157229193 18:45898249-45898271 TGGCACAGCCAGAAAGGCCCAGG - Intronic
1158352704 18:56578971-56578993 TGTCCCACCCAAGGAGGGCAAGG + Intergenic
1158388972 18:57027450-57027472 TTTCCCTGCCAGAGATGGCAGGG + Exonic
1158556306 18:58477508-58477530 TGTCCCAGCCAGAGAGCATAGGG - Intergenic
1158634821 18:59147551-59147573 TGGCACAGCCAGAGAAAGCCAGG + Intronic
1161335254 19:3709467-3709489 GCTCAGAGCCAGAGAGGGGAGGG + Intronic
1161746730 19:6064678-6064700 AGAGACAGCCAGTGAGGGCAGGG + Intronic
1162509218 19:11107368-11107390 TGTGAGAGCCAGAGAGAGGAAGG - Intronic
1162534016 19:11252748-11252770 AATCACAGGCAGAGAGGGCGTGG + Intronic
1162654555 19:12118328-12118350 TGGGACACCCAGAGAGAGCAGGG + Intronic
1163622881 19:18371256-18371278 TGTCACGGCCAGGGAGAGTAGGG + Intergenic
1163770742 19:19189585-19189607 TCTCACTGCCCGAGAGGACAAGG + Intronic
1164506555 19:28865981-28866003 GGGCACACCCAGAAAGGGCATGG + Intergenic
1165508001 19:36246938-36246960 TGGTGCAGCCAGAGACGGCATGG - Intergenic
1165784009 19:38450433-38450455 TCTCACAGCCACAGAGAACAAGG + Intronic
1166634551 19:44438791-44438813 TGACATGCCCAGAGAGGGCATGG + Intronic
1167093138 19:47358363-47358385 TGTGACAGACAGAGAGCCCATGG - Intronic
1167409730 19:49337856-49337878 TGGCACAGCCTGAGAGGGGGAGG + Intronic
1167773876 19:51542390-51542412 TCTCAGAGCCACAGAGGGCTTGG + Intergenic
1168410280 19:56135583-56135605 TGTCACCTGCAGACAGGGCAGGG + Intronic
1202684445 1_KI270712v1_random:36488-36510 GGTAACAGCCAGAGAGGACCTGG - Intergenic
925133807 2:1512673-1512695 AGTCACAGCCAGGGAGGTCAGGG - Intronic
926590128 2:14732000-14732022 TGTCCCTGCAAGAGAGGGAAGGG - Intergenic
926637245 2:15195327-15195349 TTACCCAGCAAGAGAGGGCAAGG - Intronic
926806780 2:16718417-16718439 TGGGAGAGCCAGAGAAGGCAAGG - Intergenic
927164010 2:20298949-20298971 TGGCACACCCAGGGAGGGCATGG + Intronic
927259585 2:21073873-21073895 TGTCACAGCCAAAGAAGCCTAGG - Intergenic
927478894 2:23434873-23434895 TGTCAAAGCCTGAGAGGGGGTGG + Intronic
927593164 2:24374182-24374204 TGGCATGTCCAGAGAGGGCATGG + Intergenic
928025690 2:27736768-27736790 GGTCACAGCCAGAGAGAGGTAGG + Intergenic
928248437 2:29652795-29652817 TGTCACACCCAGAGAGGGCATGG + Intronic
929536967 2:42789930-42789952 TGGCCCTGCCACAGAGGGCAGGG + Intronic
930933754 2:56920682-56920704 TGGCATGCCCAGAGAGGGCATGG + Intergenic
932418893 2:71589922-71589944 TGGGACAGCCACAGAGCGCAGGG - Intronic
932461775 2:71886676-71886698 TGGCACATCCAGAGAAGACAGGG - Intergenic
932727510 2:74192173-74192195 TCTCACAGCCACAGAGATCAAGG - Intergenic
932731601 2:74225844-74225866 ACACACAGCCAGATAGGGCAGGG - Intronic
932986635 2:76733716-76733738 TGCTGCACCCAGAGAGGGCATGG - Intergenic
933553834 2:83807870-83807892 TGGCACACCCAGGGAGGGCATGG - Intergenic
933766998 2:85716460-85716482 GCTCAGAGCCAGAGAGAGCAGGG + Intergenic
934247273 2:90318358-90318380 GGTAACAGCCAGAGAGGACCTGG + Intergenic
934262052 2:91484245-91484267 GGTAACAGCCAGAGAGGACCTGG - Intergenic
934305096 2:91815231-91815253 GGTAACAGCCAGAGAGGACCTGG - Intergenic
934328161 2:92037517-92037539 GGTAACAGCCAGAGAGGACCTGG + Intergenic
935141761 2:100359438-100359460 TGGCACATCCAGAGAGGGCATGG - Intergenic
936227756 2:110673183-110673205 TGTCACACCTGGAAAGGGCAAGG + Intronic
936458448 2:112693240-112693262 AGTCACTGGCAGAGTGGGCAGGG + Intergenic
936809176 2:116375605-116375627 TGTCCCAGGCAGAGAGAGAATGG - Intergenic
937295723 2:120808731-120808753 TTTCACAGACAGACAAGGCAAGG - Intronic
937511054 2:122595347-122595369 TGGCACAGCTGGAGAGGGCCTGG - Intergenic
937523467 2:122739036-122739058 TGGCACATCTAGAGAGGGCATGG + Intergenic
937523739 2:122742125-122742147 TGGCACAGGCAGAGATGGAATGG + Intergenic
938481946 2:131670089-131670111 TCTCCCCACCAGAGAGGGCAGGG + Intergenic
939705287 2:145445330-145445352 TGTAGCAGCCAGAGAGGCAAGGG - Intergenic
940282317 2:152000789-152000811 TGTCCCAGCCCAAGAGGTCAGGG - Intronic
942417238 2:175772168-175772190 TATCACAGCATGAGGGGGCAGGG + Intergenic
942743261 2:179203496-179203518 TAGCACACCCAGAGAGGCCATGG + Intronic
946335444 2:219032439-219032461 TGCCACAGCGAGTGAGGGCAGGG - Intronic
946768882 2:223067196-223067218 AGTCACAGCTGGAGAGGACACGG + Intronic
947400901 2:229730764-229730786 TGTCAAAGCCAGGGAGAGCCTGG - Intergenic
948663625 2:239521399-239521421 TGTCGCAGGAAGAGAGGGAATGG - Intergenic
1169396013 20:5230090-5230112 TGGCGCACCCAGGGAGGGCATGG + Intergenic
1169407744 20:5337290-5337312 TGCTTCAGCCAGAGAAGGCAGGG - Intergenic
1170016496 20:11787705-11787727 TGGCACCCCCAGAGAGTGCATGG + Intergenic
1170294948 20:14813674-14813696 TGGCACACTCAGGGAGGGCATGG - Intronic
1171389050 20:24789548-24789570 GGGCACAGCCAGGCAGGGCATGG + Intergenic
1172012138 20:31851670-31851692 GGTCATAGCCAGAGAGGGTGGGG + Intronic
1172152685 20:32801450-32801472 TGTCACAGACAGCCAGGGCAGGG + Intronic
1172771706 20:37386018-37386040 GGCCACAGCCAGGGAAGGCATGG - Intronic
1173637843 20:44576628-44576650 TGCCAGATCCAGAGAAGGCAAGG - Intronic
1174995900 20:55567956-55567978 TGTCACAACTAGAGTGGGCCAGG + Intergenic
1175838715 20:62013327-62013349 AGTCAGTGCCAGAGAGGGGAAGG + Intronic
1175974033 20:62701508-62701530 TGTCACAGGCACAGAGGTCCAGG + Intergenic
1177063536 21:16401388-16401410 TGACACACCTAAAGAGGGCATGG - Intergenic
1177322791 21:19544272-19544294 TGGCACATCCAGAGAGGGTATGG + Intergenic
1178154248 21:29832716-29832738 TGTCACAGGCCCAGAGGGCTGGG - Intronic
1179241954 21:39600583-39600605 TGTCACAGACACAGAAGGTAAGG - Intronic
1180012600 21:45060678-45060700 TGTGACAGATTGAGAGGGCAGGG + Intergenic
1180226827 21:46398527-46398549 TGTCACAGCCAGTATGGGCAGGG + Intronic
1180280446 22:10688690-10688712 GGTAACAGCCAGAGAGGACCTGG + Intergenic
1180483155 22:15773679-15773701 TCTCCCCACCAGAGAGGGCAGGG + Intergenic
1180587668 22:16907227-16907249 GGTGACAGCCAGAGAGGACCTGG + Intergenic
1180924426 22:19544094-19544116 GGCCACAGTCTGAGAGGGCAGGG - Intergenic
1181495636 22:23286074-23286096 AGTCACAGCCAGACAGTGGAGGG + Intronic
1181570292 22:23764631-23764653 TGTCACAGAGGGAGAGGACATGG + Exonic
1181593124 22:23896641-23896663 TGTCACAGATAGGGAGAGCAGGG + Intronic
1181738204 22:24898486-24898508 AGTCACAGCCAGAGAAGCCAGGG - Exonic
1181889664 22:26051182-26051204 TGTCACAGCCAGAGAAGATATGG + Intergenic
1182509517 22:30809005-30809027 AGACACAGACAGAGAGGGGAAGG + Intronic
1182764619 22:32749765-32749787 TATCATTGCCAGAGAGGGCTGGG - Intronic
1183075758 22:35425907-35425929 TGTCACAGTGAGGGAGTGCAGGG + Intergenic
1183170700 22:36185667-36185689 AGTCACAGCCTTAGAGAGCATGG + Intergenic
1183254586 22:36754143-36754165 TGATTCAGCCAGAGAGGGCGGGG - Intergenic
1183305579 22:37081380-37081402 TGTCGAAGCCAGACAGGCCAGGG - Intronic
1183398991 22:37589999-37590021 TGTGAAGGCCAGAGAGGGAAGGG - Intergenic
1183612487 22:38919341-38919363 TTTCATAGCTAGAGAGGGGAAGG - Intergenic
1184366318 22:44053881-44053903 TGGCACGCCCAGAGAGGGCATGG - Intronic
1184667294 22:45995744-45995766 TCACACAGCCGGAGAGAGCAGGG - Intergenic
1185002037 22:48252093-48252115 TGTCCCAGGCAAAGAGGACATGG - Intergenic
1185002066 22:48252229-48252251 TGTCTCAGGCAAAGAGGACATGG - Intergenic
1185002107 22:48252445-48252467 TGTCCCAGGCAAAGAGGACATGG - Intergenic
1185002136 22:48252581-48252603 TGTCTCAGGCAAAGAGGACATGG - Intergenic
1185002215 22:48252974-48252996 TGTCCCAGGCAAAGAGGACATGG - Intergenic
1185002264 22:48253218-48253240 TGTCCCAGGCAAAGAGGACATGG - Intergenic
1185129250 22:49028318-49028340 TGGCAGAGCCAGAGTGGACAAGG + Intergenic
949197118 3:1324941-1324963 TGCCACAGCCTGAGAGTCCAAGG + Intronic
949697438 3:6715370-6715392 TGTCACAGCTTGAGGGGGAAGGG + Intergenic
949801921 3:7913718-7913740 TGGCACACCTGGAGAGGGCATGG + Intergenic
950544660 3:13631231-13631253 TGTCACAGCCATAGAGCTTAGGG - Intronic
950652403 3:14415479-14415501 TGTCTCAGGGGGAGAGGGCATGG - Intronic
950828470 3:15850658-15850680 TGGCATCCCCAGAGAGGGCATGG + Intronic
951402656 3:22252700-22252722 TGTGTCAGACAGAGATGGCATGG + Intronic
951579716 3:24149202-24149224 TGTCACAGACAGGGAGGGGAGGG + Intronic
951613287 3:24516384-24516406 TGTCACAGCCAAATAGGAAATGG - Intergenic
952324002 3:32304335-32304357 TGTTACAATCAGAGAGGCCAAGG - Intronic
952852232 3:37738834-37738856 CATAACAGTCAGAGAGGGCAGGG + Intronic
954116380 3:48469079-48469101 AGTGGCAGCCAGAGAGGCCAGGG + Exonic
954285800 3:49618036-49618058 TGTCAGAACCAGAGAAGTCAGGG - Intronic
954642777 3:52111731-52111753 TGTCTGAGCCAGAGATGGCTTGG - Intronic
954807878 3:53230816-53230838 TTTCACAGCCAGAAGGGGCCGGG - Intronic
954978030 3:54715347-54715369 TGGTGCATCCAGAGAGGGCATGG - Intronic
955287552 3:57657860-57657882 AGGAACAGCCAGAGAGGGAATGG + Intronic
956230788 3:67014155-67014177 TGGCACAGCCAGAAAGAGGATGG - Intergenic
956286182 3:67613019-67613041 TGGTACCCCCAGAGAGGGCATGG - Intronic
956653747 3:71529738-71529760 TGCCACCTCCAGAGAAGGCATGG + Intronic
957026989 3:75193305-75193327 TGGCATACCCAGAGAGGGCTGGG - Intergenic
957959891 3:87236046-87236068 TGGCACACACAGAGAGGGCATGG - Intronic
958130233 3:89409840-89409862 AGGCCCAGCCAGAAAGGGCAAGG - Intronic
958264927 3:91426908-91426930 TGGAACACCCAGAGAGGGCATGG + Intergenic
958535310 3:95395565-95395587 TGTAAGATCCAGAGGGGGCAGGG - Intergenic
960829469 3:121831099-121831121 TATCACAGGCAGGGAGGACATGG + Intronic
960991244 3:123313130-123313152 GTGGACAGCCAGAGAGGGCAGGG - Intronic
961567763 3:127775899-127775921 AGTCTCACCCAGAGGGGGCAAGG - Intronic
961623816 3:128245369-128245391 TGCTACAGCCACAGAGGGGATGG - Intronic
961992211 3:131204205-131204227 TGGCACACCCAGGAAGGGCATGG + Intronic
962313033 3:134339304-134339326 TCTCACAGGAACAGAGGGCATGG + Intergenic
962712585 3:138100310-138100332 TGTCACACTCAGAAAGGGCAGGG + Intronic
962965514 3:140350088-140350110 TGTCAAAGCCAGAGATTGCAAGG - Intronic
963042579 3:141080502-141080524 TGTCACAGCTACAGAGGTCGGGG - Intronic
963674241 3:148288307-148288329 TGGCACAGGCAGGGAGGGCATGG - Intergenic
963726044 3:148922892-148922914 TGGCATGACCAGAGAGGGCATGG + Intergenic
963791449 3:149586908-149586930 TGGCACATCCAGAGAGGGTGTGG + Intronic
964111773 3:153095633-153095655 TGGCACACCCAGAAAAGGCATGG - Intergenic
964354300 3:155835901-155835923 TCTCACAGCCACAGAGATCAAGG - Intronic
967732410 3:192918118-192918140 TGCCGCTGCCAGAGAGGGCCAGG - Exonic
968245271 3:197139732-197139754 TTTCCCAGCCAGAGAGGAAATGG + Intronic
968245276 3:197139796-197139818 TTTCCCAGCCAGAGAGGAAATGG + Intronic
968450926 4:675583-675605 TTTCTCAGCCAGAGAGGCCCAGG - Intronic
968726993 4:2252364-2252386 TGAGGCAGCCAGACAGGGCAGGG + Intronic
968894110 4:3388719-3388741 TGTCACTGCCGTGGAGGGCAGGG - Intronic
969497706 4:7535395-7535417 TGCCCCAGCCAGAGAAGCCAGGG - Intronic
969854201 4:9985930-9985952 TCACACAGCCAGAGGTGGCAAGG - Intronic
970463935 4:16304407-16304429 TGTGCCAGGCAGAGAGGGAAGGG + Intergenic
970628874 4:17919972-17919994 TGGCACACCCAGGGAGGGCATGG + Intronic
971023630 4:22565871-22565893 TGGCATGCCCAGAGAGGGCATGG + Intergenic
972782898 4:42301391-42301413 TGGTGCATCCAGAGAGGGCATGG - Intergenic
974535871 4:63174380-63174402 TGTTGCATCCAGGGAGGGCATGG + Intergenic
974934828 4:68399548-68399570 TGGCGCACCCAGGGAGGGCATGG + Intergenic
975491082 4:74989501-74989523 GGTGGCTGCCAGAGAGGGCATGG - Intronic
976067080 4:81200229-81200251 TATCACTGGCAGAGAGGGCAGGG - Intronic
978706471 4:111718797-111718819 AGACACAGCCAGAGGGGGGAGGG + Intergenic
980765770 4:137301745-137301767 TGGCACACCCAGGGAGGGCATGG - Intergenic
980883168 4:138734119-138734141 TTTCACATTCAGAGAAGGCAGGG - Intergenic
981434082 4:144699383-144699405 TGGCACACCCAGAGAGGGCAGGG - Intronic
981643554 4:146972915-146972937 TGGTGCACCCAGAGAGGGCATGG - Intergenic
983079982 4:163372952-163372974 TGGCGCACCCAGGGAGGGCATGG - Intergenic
983198884 4:164839016-164839038 TGTCAAAGCAAGAGAGGCAATGG + Intergenic
983986367 4:174064890-174064912 TGTCATAGCAAGAGAGGCCTGGG + Intergenic
984983016 4:185301293-185301315 TGACACACCCAGGGAGGGCATGG + Intronic
987203060 5:15596829-15596851 TGGTGCACCCAGAGAGGGCATGG + Intronic
988094046 5:26579922-26579944 TATCACAGCTAAAGAGGGCTGGG + Intergenic
988480559 5:31626964-31626986 TGCCACATCTAGCGAGGGCAGGG + Intergenic
988537411 5:32081255-32081277 TGGGAAATCCAGAGAGGGCAAGG - Intronic
988586385 5:32511186-32511208 TGTCAGAGCCAGAGAAGGCTAGG + Intergenic
990473689 5:56141624-56141646 TGGCACACCCAGAGAGGGCACGG + Intronic
990515903 5:56530607-56530629 TTTGGCAGTCAGAGAGGGCAGGG - Intronic
990775444 5:59301025-59301047 TGGCACAGCCAGGTAAGGCATGG - Intronic
991396157 5:66207375-66207397 TAGTACACCCAGAGAGGGCATGG - Intergenic
991602646 5:68368896-68368918 TAACACAGCCTGAGGGGGCAGGG + Intergenic
994017913 5:94989894-94989916 TGTCACAGCCAGAGAGGGCATGG + Intronic
995175252 5:109168561-109168583 TGGTGCACCCAGAGAGGGCATGG + Intronic
995494021 5:112722779-112722801 TGGTACACCCAGAGAAGGCATGG - Intronic
995594547 5:113733971-113733993 TGACACACCCAGAGAAGGCATGG - Intergenic
995897289 5:117029660-117029682 TGTCACATAAAGAGATGGCAAGG + Intergenic
997105120 5:131009233-131009255 GTTCAGAGACAGAGAGGGCAGGG + Intergenic
997303272 5:132821888-132821910 TGTCACAGCCACAAAGGCCTAGG - Intergenic
997505390 5:134412604-134412626 GGTCAAAGCAAGAGAGAGCATGG + Intergenic
997610661 5:135213467-135213489 GGTTACAGGCAGAGAGGGCTCGG - Intronic
997645320 5:135477848-135477870 TTTCCAAGGCAGAGAGGGCAGGG + Intergenic
997789864 5:136749183-136749205 TCTCACAGTGAGAGAGAGCATGG - Intergenic
999106039 5:149072010-149072032 TGGCACACCTGGAGAGGGCATGG + Intergenic
999747262 5:154601759-154601781 TGTCACAGTCAAGGAGGGCCTGG - Intergenic
999870321 5:155743015-155743037 TGGTACACCTAGAGAGGGCAAGG - Intergenic
1000925885 5:167193483-167193505 TGTAACAGACAGAAAGGGCAGGG + Intergenic
1001467722 5:171983259-171983281 TGGCACACTCACAGAGGGCATGG + Intronic
1002200558 5:177525402-177525424 AGTCACACCCACAGAGGGTAGGG + Intronic
1003348619 6:5294761-5294783 TGGAACACCCAGGGAGGGCATGG - Intronic
1004387894 6:15188234-15188256 TGGCACAACCAGGGAGGCCATGG - Intergenic
1005152858 6:22772624-22772646 TGGCACGCCCAGGGAGGGCATGG + Intergenic
1005416391 6:25604649-25604671 TGTCCCAGCCAGAGAGCCTATGG + Intronic
1005762491 6:28980194-28980216 TCTCACAGCCACAGAGATCAAGG - Intergenic
1006408162 6:33857035-33857057 TGCCAAGACCAGAGAGGGCAAGG + Intergenic
1006421029 6:33934298-33934320 GGACACAGCCAGAGAGGGCGTGG - Intergenic
1006691949 6:35895930-35895952 TGGTACACCCAGAGAGGGCATGG + Intronic
1007535879 6:42588289-42588311 TGGCATGCCCAGAGAGGGCATGG - Intronic
1007811858 6:44491916-44491938 TGGTGCACCCAGAGAGGGCATGG + Intergenic
1008079588 6:47180134-47180156 TGTCAAAGGCAGGGTGGGCATGG - Intergenic
1008656548 6:53619756-53619778 TGGCACATGCAGAGAGGGCATGG - Intergenic
1008990456 6:57595752-57595774 TGGAACACCCAGAGAGGGCATGG - Intronic
1009179032 6:60494298-60494320 TGGAACACCCAGAGAGGGCATGG - Intergenic
1010068833 6:71719012-71719034 TGTCAGAGCTTGACAGGGCAAGG + Intergenic
1010238130 6:73591960-73591982 TGGCACGCCCAGAGAGGGCATGG - Intergenic
1010970024 6:82253296-82253318 TGGCACACACAGGGAGGGCATGG + Intergenic
1012779377 6:103537156-103537178 GGTCACAGCCAGCTAGGGAAAGG - Intergenic
1014237158 6:118970816-118970838 TGTCAGAGCCAAAGAAAGCAGGG - Intronic
1014551956 6:122799300-122799322 TGTCACAGCCAAAAAGGACTGGG + Intronic
1014806808 6:125838967-125838989 TGGTGCACCCAGAGAGGGCATGG - Intronic
1016986684 6:149900711-149900733 AGTCACAGCAGGACAGGGCAGGG - Intergenic
1018131778 6:160738707-160738729 TGTCACAGCCAGAGAAGGAAGGG - Intronic
1019097732 6:169598712-169598734 TGTAGCAGCCACAGAGGCCAGGG + Intronic
1019173057 6:170145649-170145671 TGGCACAGGCAGGGAGGGCCGGG - Intergenic
1019208353 6:170382318-170382340 TGTTTGAGCCAGAGAGGTCAGGG + Intronic
1019537888 7:1538430-1538452 TGTCACAGCCGCAGCGGCCAGGG + Intronic
1019739833 7:2667147-2667169 GGTCAGAGCCAGAGACGACATGG - Intergenic
1020211929 7:6164206-6164228 TCTGACAGCCTGACAGGGCAGGG + Exonic
1021507744 7:21403995-21404017 TGTCATGCCCAAAGAGGGCATGG - Intergenic
1021745620 7:23738288-23738310 TGGCACACTCAGAAAGGGCATGG - Intronic
1021788658 7:24178175-24178197 TGATACAGCCAGAGAGAGAAGGG - Intergenic
1022405908 7:30089650-30089672 TGCTACAGCCAGAAAGGGGATGG + Intronic
1023609810 7:41961366-41961388 TGCACCAGCCAGAGAGCGCACGG - Exonic
1023730304 7:43185210-43185232 TAGCACACCTAGAGAGGGCATGG + Intronic
1023744945 7:43314410-43314432 AGTCACAGTGAGAGGGGGCAGGG + Intronic
1023899343 7:44463336-44463358 GGTGACACCCACAGAGGGCACGG + Intronic
1024541737 7:50480316-50480338 TGGCATACACAGAGAGGGCATGG + Intronic
1025071320 7:55901655-55901677 TGCCATGCCCAGAGAGGGCATGG + Intronic
1026740301 7:72975010-72975032 AGACGCAGCCAGTGAGGGCAGGG - Intergenic
1026797608 7:73376519-73376541 AGACGCAGCCAGTGAGGGCAGGG - Intergenic
1026951984 7:74353818-74353840 TGGCACAGGCAGAGATGGCAGGG - Intronic
1027103430 7:75390060-75390082 AGACGCAGCCAGTGAGGGCAGGG + Intergenic
1027532441 7:79353366-79353388 TGCCACAGCCAGAGACAGCAAGG - Intronic
1027580945 7:79994671-79994693 AGACACAGCCAAAGAGGGAAGGG - Intergenic
1027659489 7:80971823-80971845 TGTCACAGCTAGAGAGGTGCTGG + Intergenic
1029250376 7:99232269-99232291 AGTCAAGGCCAGAGAGGGCGGGG + Intergenic
1029347349 7:99988027-99988049 CCTCACAGCCAGAGTGGCCATGG - Intergenic
1031027428 7:116695520-116695542 TCACACAGCTAGAGAGGGAAAGG + Intronic
1033196391 7:139331322-139331344 TGGTATACCCAGAGAGGGCATGG - Intergenic
1033254399 7:139787515-139787537 TTTAATAGCCAGAGAGGGGAAGG + Intronic
1034202317 7:149290191-149290213 TCTGACACCCAGAGAGGGCCTGG + Intronic
1034249897 7:149681240-149681262 TGGCACATCTGGAGAGGGCATGG - Intergenic
1034476054 7:151282754-151282776 TGGCTCAGCCAGGGAGGGGAAGG - Intergenic
1034528971 7:151683739-151683761 TGCCACAGCCAGAGAGGGACAGG + Intronic
1034640126 7:152595807-152595829 TGTCACATCCATTGAAGGCAAGG + Intergenic
1037340051 8:17834961-17834983 TGTGAAAGACAGAGAGGTCAAGG - Intergenic
1037802015 8:22041045-22041067 GATGAGAGCCAGAGAGGGCAAGG - Intergenic
1038132376 8:24747206-24747228 TGTCACAACCAGAGAATACAAGG + Intergenic
1038162192 8:25050378-25050400 TCTCAAAGCCAGAGAGACCAAGG + Intergenic
1038696055 8:29807338-29807360 TGTCACAGGCAGGGCGGGGAAGG - Intergenic
1039229725 8:35430318-35430340 TGGCACACCCTGAGAGGGCATGG + Intronic
1039536932 8:38324908-38324930 TGGCATGGCCAGAGAGGGCATGG + Intronic
1039597868 8:38807098-38807120 TGGCATTCCCAGAGAGGGCATGG - Intronic
1039849219 8:41347904-41347926 TCTCACAGCCACAGAGAACAAGG + Intergenic
1041357365 8:57014563-57014585 TTTCTGAGCCAGCGAGGGCAGGG + Intergenic
1041674161 8:60521275-60521297 AGGCACCGCCAGAGTGGGCATGG + Intronic
1042096165 8:65218042-65218064 TGGCATCCCCAGAGAGGGCATGG + Intergenic
1042897978 8:73692133-73692155 TGGCACACCCAGACAGGGCTTGG + Intronic
1043091315 8:75907893-75907915 TGGTACACCCAGGGAGGGCATGG + Intergenic
1043487144 8:80709576-80709598 AGTGAGAGCCAGAGAAGGCAGGG + Intronic
1043515622 8:80992220-80992242 TGTCCCAGCCACAGAGGTCTGGG + Intronic
1044030776 8:87233758-87233780 TGCCACAGCCAAACTGGGCATGG - Intronic
1045331899 8:101162370-101162392 TGGTACACCCAGAGAGGGCATGG + Intergenic
1045585573 8:103531493-103531515 TGTTACACCTGGAGAGGGCATGG + Intronic
1045826391 8:106403333-106403355 TGTCACAGGCAAGGTGGGCAGGG - Intronic
1046240463 8:111484350-111484372 TGTCAGAGCCAGTGAGTACACGG - Intergenic
1046332866 8:112744320-112744342 TGTTACATCCAGAAATGGCATGG - Intronic
1046839114 8:118837971-118837993 TGGCACACCCAGAAAAGGCAGGG - Intergenic
1047199375 8:122751957-122751979 CGACACAGCAAGAGAGTGCAGGG + Intergenic
1047621548 8:126612984-126613006 GGTGGCACCCAGAGAGGGCATGG - Intergenic
1047813350 8:128434528-128434550 AGACACAGCCAGGGAAGGCATGG - Intergenic
1048000939 8:130379203-130379225 TGGCACGTCCCGAGAGGGCATGG + Intronic
1048504424 8:135007957-135007979 TCCCACAGCCAGAGTGGGAATGG - Intergenic
1049041944 8:140119097-140119119 TGTCACAGCAAGATAAGGCAAGG + Intronic
1049256052 8:141614457-141614479 TGGTACAGCCAGAGTGGACAAGG + Intergenic
1049607326 8:143535826-143535848 TGTGACACTCAGAAAGGGCAGGG + Intronic
1050030194 9:1377991-1378013 TGTAAAAGCCAGAGAGCCCATGG + Intergenic
1050139492 9:2502622-2502644 TGTCTTACCCAGAAAGGGCATGG - Intergenic
1051481349 9:17564679-17564701 TGTGACAGCAAGAGAGAGCCAGG + Intergenic
1053696589 9:40644827-40644849 GGTAACAGCCAGAGAGGACCTGG + Intergenic
1053787200 9:41660634-41660656 TGCCAGAGCAAGAGAGGGGAGGG + Intergenic
1053943011 9:43275037-43275059 GGTAACAGCCAGAGAGGACCTGG + Intergenic
1054175477 9:61871973-61871995 TGCCAGAGCAAGAGAGGGGAGGG + Intergenic
1054307839 9:63444055-63444077 GGTAACAGCCAGAGAGGACCTGG + Intergenic
1054406565 9:64768057-64768079 GGTAACAGCCAGAGAGGACCTGG + Intergenic
1054440195 9:65253530-65253552 GGTAACAGCCAGAGAGGACCTGG + Intergenic
1054490210 9:65768409-65768431 GGTAACAGCCAGAGAGGACCTGG - Intergenic
1054662060 9:67708837-67708859 TGCCAGAGCAAGAGAGGGGAGGG - Intergenic
1054701644 9:68418850-68418872 TGTCAGAGTCAGAGAGAGTAAGG + Intronic
1054710452 9:68505673-68505695 TGTCTTACCCAGAGAGGGCATGG - Intronic
1056173819 9:84014460-84014482 TAGCACAGCTGGAGAGGGCATGG + Intergenic
1056342601 9:85652580-85652602 TGGCATACCTAGAGAGGGCATGG + Intronic
1056382233 9:86065659-86065681 AGTGAGAGCCAGAGAGGTCATGG - Intronic
1056465177 9:86846742-86846764 TGCTACAGACACAGAGGGCAGGG + Intergenic
1056722861 9:89086492-89086514 CGTCACATCCTGGGAGGGCATGG - Intronic
1056956516 9:91086086-91086108 TGGCACACTCAGAGGGGGCATGG + Intergenic
1057021249 9:91699219-91699241 TGGCACACCCGGGGAGGGCATGG + Intronic
1057421531 9:94916921-94916943 TGTCACATTGAGAGAGGGAAAGG + Intronic
1057526849 9:95810592-95810614 TGGCACACCCGGAGAGGGCATGG - Intergenic
1057936421 9:99243118-99243140 TCTCACAGGTAGAGAGGACAAGG - Intergenic
1058726924 9:107813327-107813349 TGGTACACTCAGAGAGGGCATGG - Intergenic
1058784868 9:108377048-108377070 TGGAACACCCAGAGAGGTCATGG + Intergenic
1059244055 9:112834520-112834542 TGCTACACCCAGGGAGGGCATGG - Intronic
1059436174 9:114277780-114277802 GGGCAAAACCAGAGAGGGCAGGG - Intronic
1059721006 9:116960076-116960098 CGTCACAGCCAGGGAGGGCAGGG + Intronic
1060427018 9:123514495-123514517 TGTCAGAGTCAGGGAGGGCAAGG + Intronic
1060588156 9:124799614-124799636 TGGCACAGCCAGAGAGTCCCTGG + Intronic
1060712959 9:125889253-125889275 GCCCACAGCCAGAGAGGGAAAGG - Intronic
1061401197 9:130369453-130369475 TCACACAGCCAGCGATGGCAAGG + Intronic
1062044544 9:134418962-134418984 TGTCCTATCCAGAAAGGGCAGGG - Intronic
1062197180 9:135280811-135280833 TGGCACAGCCAGAGGCAGCAAGG + Intergenic
1062394954 9:136349073-136349095 GGTCAGAGTCCGAGAGGGCAGGG - Intronic
1062483475 9:136763132-136763154 GGTCACAGCAGGAGAGGGCATGG + Intronic
1202779039 9_KI270717v1_random:18487-18509 GGTAACAGCCAGAGAGGACCTGG + Intergenic
1203586108 Un_KI270747v1:4896-4918 GGTAACAGCCAGAGAGGACCTGG + Intergenic
1185582239 X:1218533-1218555 TGTCACAGCAAGAGCTGGGAGGG - Intergenic
1186635215 X:11396442-11396464 TCTCTCCTCCAGAGAGGGCAGGG + Intronic
1189219157 X:39356278-39356300 TGTCTCTGCCAGTGTGGGCAGGG + Intergenic
1189472187 X:41322897-41322919 AGTGGCAGCCAGAGAGGCCAGGG + Intergenic
1189831740 X:44981436-44981458 TGACATGCCCAGAGAGGGCATGG - Intronic
1189860968 X:45271578-45271600 AGTGACAGACAGAGAGGGAAAGG + Intergenic
1192729176 X:73785474-73785496 TGGCACACCCAGGGAGGGCATGG - Intergenic
1193490950 X:82146552-82146574 TCACACAGCCAGGGAGGGCCTGG + Intergenic
1197034175 X:121854304-121854326 TGTGGCAGGGAGAGAGGGCATGG - Intergenic
1197337930 X:125231105-125231127 TGGCACACCCAGGGAGGGCGTGG + Intergenic
1197584095 X:128323286-128323308 TTTCACAGAGAGAGAGGTCATGG + Intergenic
1197718541 X:129728175-129728197 TGTTGCAGCCAGAGAGGGGCTGG + Intergenic
1200072160 X:153534544-153534566 TGTCCCAGCTAGAGAGGGACGGG + Intronic
1200921575 Y:8618073-8618095 TGCCACAGGCAGAGCCGGCATGG - Intergenic
1201157986 Y:11150192-11150214 TATCACACCCAGAGAGCGAAGGG - Intergenic