ID: 994028581

View in Genome Browser
Species Human (GRCh38)
Location 5:95114388-95114410
Sequence CTGTCCCAAGGGCAGGTCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994028581_994028588 1 Left 994028581 5:95114388-95114410 CCTTCGACCTGCCCTTGGGACAG 0: 1
1: 0
2: 2
3: 11
4: 130
Right 994028588 5:95114412-95114434 GGGAAGACCACTGCCCTGAAGGG 0: 1
1: 20
2: 158
3: 405
4: 650
994028581_994028587 0 Left 994028581 5:95114388-95114410 CCTTCGACCTGCCCTTGGGACAG 0: 1
1: 0
2: 2
3: 11
4: 130
Right 994028587 5:95114411-95114433 AGGGAAGACCACTGCCCTGAAGG No data
994028581_994028593 17 Left 994028581 5:95114388-95114410 CCTTCGACCTGCCCTTGGGACAG 0: 1
1: 0
2: 2
3: 11
4: 130
Right 994028593 5:95114428-95114450 TGAAGGGTGAGTAGCAGGCCAGG No data
994028581_994028590 12 Left 994028581 5:95114388-95114410 CCTTCGACCTGCCCTTGGGACAG 0: 1
1: 0
2: 2
3: 11
4: 130
Right 994028590 5:95114423-95114445 TGCCCTGAAGGGTGAGTAGCAGG 0: 1
1: 5
2: 157
3: 350
4: 571

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994028581 Original CRISPR CTGTCCCAAGGGCAGGTCGA AGG (reversed) Intronic
900965063 1:5952141-5952163 CTGTGACACGGGCAGGCCGAGGG + Intronic
901004073 1:6163278-6163300 CTTTCCCCAGTGCAGGTGGATGG - Intronic
901231180 1:7642419-7642441 CTTTCCCAAGGGCAGGCCAGAGG + Intronic
902210147 1:14899165-14899187 CTGTACCAAGGTCAGGAAGATGG + Intronic
903225976 1:21894454-21894476 CTGCCCCAAGGGCAGCTGGCAGG + Intronic
903343837 1:22671951-22671973 CAGTCCCAATGGCAGGATGAGGG + Intergenic
903643450 1:24876122-24876144 CTTTCCCAAGGGCAGCCCGGCGG - Intergenic
906287038 1:44594326-44594348 CAGTCCCAAGTGCAGGTGAAGGG - Intronic
912128400 1:106569811-106569833 CTTTCCCAAGGCCAGGTTCAGGG + Intergenic
912517685 1:110226387-110226409 CTTTCCCATGGGCAGCTGGATGG - Intronic
915903392 1:159862015-159862037 CTCTCCCAAGGCCAGGGCCAAGG - Intronic
916461528 1:165029639-165029661 CTGTCCCCAGTTCAGATCGATGG - Intergenic
917630772 1:176889247-176889269 CTATCCCAAGGGGAGGGAGAGGG + Intronic
919685973 1:200483968-200483990 CAGTGCTAAGGGCAGGTTGATGG - Intergenic
920667505 1:207974091-207974113 CTGTCCAAAGAGCAGGTTGCTGG + Intergenic
924946321 1:248849276-248849298 ATGTCCCCAGGGCAGATCAAGGG + Exonic
1062839223 10:657395-657417 CAGGTCCAAGGGCAGGTCCAGGG - Intronic
1062839399 10:658019-658041 CAGGTCCAAGGGCAGGTCCAGGG - Intronic
1064541083 10:16405923-16405945 CTGTTCCCAGGGCAGGGGGAGGG + Intergenic
1065144254 10:22751959-22751981 CTGGCCCAATGGCAGGGGGAAGG + Intergenic
1067135839 10:43606612-43606634 CTTTCCCAGGGGCGGGTCGAGGG + Intronic
1069486451 10:68827161-68827183 CGGCCCCAAAGCCAGGTCGAAGG + Intergenic
1076850860 10:133092008-133092030 CTGGCCCAAAGGCAGGTTGTGGG + Intronic
1080457290 11:32428796-32428818 CTGTCCCAAGGTCACATCCAGGG - Intronic
1081747038 11:45480690-45480712 CTGTCCCCAGGGAAGGTGGTGGG + Intergenic
1083278650 11:61611752-61611774 CTCTCCTGAGGGCAGGTAGATGG - Intergenic
1084427641 11:69094321-69094343 CTGTCCCCAGTGCAGGTGGCTGG + Intergenic
1084929157 11:72540317-72540339 CAGTCCCAAGGCCAGGTCCTGGG + Intergenic
1089009239 11:115119273-115119295 CTGGCCCAAGGGAAGGGGGAGGG + Intergenic
1089281482 11:117377639-117377661 CTCTCTCAAGGGCAGGACCAGGG + Intronic
1096326920 12:50671332-50671354 CTGTCCCACGGAGAGGTCAAAGG + Exonic
1102807046 12:115791364-115791386 CGGTCCCAAGTGGAGGGCGATGG - Intergenic
1103934738 12:124469127-124469149 CTGGCCCAAGGTCAGATGGAAGG + Intronic
1110915967 13:81021207-81021229 TTGTCCCAAGGGCAGGTTGGAGG - Intergenic
1122218662 14:100221324-100221346 CTGTCCTAAGGGCAGATTTATGG - Intergenic
1127758324 15:62113950-62113972 CTGCCCTGAGGGCAGGTGGAGGG - Intergenic
1128349198 15:66877825-66877847 CTGACCCAAGCCCAGGTGGAAGG + Intergenic
1128688667 15:69706675-69706697 CTGTCCCTAGGGCAGTTGGCTGG + Intergenic
1129297620 15:74608618-74608640 CTGGCCCAGGGGCAGGTGGGAGG - Intronic
1129732217 15:77939029-77939051 CTGTCCCAGAGGCAGGTCTGAGG - Intergenic
1132642617 16:984691-984713 CTGTCCCCAGGGCAGACCCACGG + Exonic
1137941972 16:52696738-52696760 ATGTCCCAAGGGCAGGGCAGTGG + Intergenic
1139133814 16:64178086-64178108 ATGTCTCCAGGGCAGGTCAAAGG + Intergenic
1139421805 16:66853673-66853695 CTGTCCCCAGGGCAGCTGAAGGG - Exonic
1143680791 17:8474743-8474765 CTGTCCAAAGGGAAGGGAGAAGG + Exonic
1144393040 17:14813849-14813871 CTTTTCAAGGGGCAGGTCGAGGG - Intergenic
1146122577 17:30208492-30208514 CAGTTCCTAGGGCAGGTCTATGG + Intronic
1147176329 17:38658357-38658379 CTGGCCTAAGGGGAGGTCCACGG + Intergenic
1147319642 17:39637975-39637997 CTGTCCCAATGGCCGCTGGATGG - Intronic
1147341704 17:39756323-39756345 CTGGCCCAAGGGATGGTGGAGGG - Intergenic
1147459577 17:40559649-40559671 CTGTCCCAAAGGCAGGCCAAGGG - Intronic
1150229905 17:63544146-63544168 GTGTCCCCAGGGCAGGTAGGGGG + Intronic
1151548140 17:74805913-74805935 CTGTTCCCAGGGCAGGGCGGGGG + Intronic
1151953702 17:77370000-77370022 CTGTCCCAAGGGAAGGGGGATGG - Intronic
1152927357 17:83093384-83093406 CTGTCCCCAGGGCTGGTGGAGGG - Intronic
1154388185 18:13914242-13914264 GTGTCCCAAAGGCAGGGTGAGGG + Intronic
1155522742 18:26685547-26685569 CTGTCCCCAGGGAAGGCCAAGGG + Intergenic
1155555161 18:27010872-27010894 CTGTCTCAAGGGCAGATGGGTGG + Intronic
1157469673 18:47979587-47979609 CTGTCTCAAGGGCTGGCAGAGGG - Intergenic
1160724752 19:613174-613196 CGGTCCCAGAGGCAGGGCGAGGG + Intronic
1161482880 19:4519529-4519551 CTGTCTCAGGGGCAGGTAGGAGG - Intergenic
1162909659 19:13842270-13842292 CCGTCCAAAGGCCAGGTCGGGGG + Intergenic
1162951105 19:14072650-14072672 CTGTCCCGAGGGCGGGGCCAGGG + Intronic
1163045518 19:14638648-14638670 CAGTCCCAAGGGCAGGTTGAAGG - Intronic
1163591363 19:18195923-18195945 CTGGCCCAAGGGCAGGTAGAGGG + Intronic
1165348342 19:35262757-35262779 CTGTCCTGGGGGCAGGTGGATGG - Intronic
1165794801 19:38512494-38512516 CTGACCCAAGGGCAGGTTGCGGG + Intronic
1165849234 19:38839725-38839747 CTGTCCCATGGGAAGGCAGAAGG + Intronic
1167399405 19:49255071-49255093 TTGTCCTCAGGGCAGGTGGAAGG + Intergenic
927853174 2:26512622-26512644 CTGGCCCAGGGGCAGGTATAGGG - Intronic
928240136 2:29578881-29578903 TTGTCTGAAGGGCAGGTCCAGGG - Intronic
932240197 2:70150386-70150408 CAGTTCCAAGGGCTGGTCCAAGG + Exonic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933258215 2:80104315-80104337 CTGTCCCAAAGGCAGATAGATGG + Intronic
934573877 2:95388549-95388571 CTGTCCTCAGGGCAGGGTGAGGG - Intergenic
934754745 2:96817080-96817102 CTGCCCCACGGGCAGCGCGACGG - Exonic
934945085 2:98534958-98534980 CTTAGCCAAGGGCAGGTGGAGGG + Intronic
937648241 2:124290086-124290108 CAGTTCCAAGGGGAAGTCGAGGG - Intronic
938145974 2:128835227-128835249 TTGTCCCAAGGGCCTGTGGAGGG - Intergenic
939597554 2:144145672-144145694 GTTTCCCAAGGTCAGGCCGAAGG + Exonic
948781587 2:240324855-240324877 CTGTCCCATGTGCCGGTGGAGGG - Intergenic
1175949843 20:62577596-62577618 CTCGCCCAAGGGCAGCTGGAGGG + Intergenic
1176306040 21:5123644-5123666 CTGTTTCAAGGGCAGGTTGGAGG - Intronic
1179534380 21:42041945-42041967 CTGTTCCCAGGGCAGGCTGAAGG + Intergenic
1179851017 21:44138387-44138409 CTGTTTCAAGGGCAGGTTGGAGG + Intronic
1180188091 21:46150321-46150343 CTGTCCCGTGGGCAGGGCGGGGG - Intronic
1181013195 22:20054118-20054140 CTTCCACAAGGGCAGGTCCATGG + Intronic
1182278816 22:29206436-29206458 CTTTCCCAAGTGCAGGGGGAGGG - Intronic
1182572188 22:31247892-31247914 CTGTCCCCAGGACAGGCAGAGGG + Intronic
1183728440 22:39602815-39602837 CTTTCTCTAGGGCAGGTCTAAGG + Intronic
1184066763 22:42125780-42125802 CTGTCCCTAGGGCAGGCCTGTGG + Intergenic
1184069231 22:42137932-42137954 CTGTCCCTAGGGCAGGCCTGTGG + Intergenic
1184599623 22:45535382-45535404 CTGCCCCAAGGCTAGGTCGCTGG - Intronic
949890868 3:8733035-8733057 CTGTCACTAGGGCAGGGTGAAGG + Intronic
953143477 3:40250850-40250872 CTGCCCAAAGGGCAGGGAGATGG + Intronic
954429661 3:50463787-50463809 CTGTCCCAGGGGGAGAACGAAGG + Intronic
954456372 3:50601833-50601855 GTGTTCCAAGGGCAGTTTGAGGG - Intergenic
960139626 3:114139614-114139636 CACTCCAAAGGGCAGGTAGAAGG + Exonic
961448493 3:126992023-126992045 CTGGGCCAAGGGCAGGGCAAGGG + Intronic
961791606 3:129380605-129380627 CTGTCCCCAGGGCAGGGAGCAGG + Intergenic
963107754 3:141660752-141660774 CTGTCCCGAGGGGATGTGGAGGG - Intergenic
967137632 3:186525864-186525886 CTATCTCCAAGGCAGGTCGATGG + Intergenic
968510265 4:992463-992485 CTGTCCCAAGTCCAGGCGGATGG - Intronic
968589094 4:1448874-1448896 CTGTTCCGAGGGCAGGGCGGGGG + Intergenic
968771924 4:2512905-2512927 CTGCCCCAAGGGCATGTGGGAGG - Intronic
969293364 4:6254526-6254548 CATTCCCATGGGCAGGTCCAGGG + Intergenic
969521422 4:7679983-7680005 CTGTCCTCAGGGCAGGTAGAAGG - Intronic
994028581 5:95114388-95114410 CTGTCCCAAGGGCAGGTCGAAGG - Intronic
994106880 5:95959439-95959461 CTGTTCCAAGGGAAGGGCGTGGG - Intronic
995017712 5:107330628-107330650 CTGTCCCAAGGGCAGGTTTCAGG - Intergenic
995840413 5:116438517-116438539 CTGCCCCAAGGGCAGGAGGAAGG + Intergenic
997197389 5:131989113-131989135 CTGCCCCAAGGACAGTTCCATGG + Intronic
997739742 5:136243134-136243156 CTGTCCCAAGGGGAAGAGGAAGG - Intronic
999255361 5:150206922-150206944 CTGTCCCACAGCCAGGTGGAAGG + Intronic
1001573975 5:172749859-172749881 CTCTCCAAAGGGCAGGACAATGG + Intergenic
1002134715 5:177100518-177100540 CCTTCCCAAGGTCAGGTCCAAGG - Intergenic
1002636556 5:180611640-180611662 CAGTCCCGAGGGCAGAGCGAGGG - Intronic
1005682065 6:28217620-28217642 CCGGCCCCAGGGCAGGTAGACGG + Intergenic
1007601916 6:43087489-43087511 CAGTCCCAAAGGCAGGTCTTGGG + Intronic
1008656251 6:53617064-53617086 TTGTTCCAAGGGCAGGACAAAGG + Intergenic
1012643755 6:101654439-101654461 CTTTCCCAAGGTCAGGTAGTTGG + Intronic
1013646485 6:112146602-112146624 CTTTCCTAAGGGCAGGGCCATGG + Intronic
1018074653 6:160200985-160201007 CTGTTCCCAGGGCACATCGATGG + Intronic
1018663690 6:166113835-166113857 CTGGCCCCAGGGCAGGCAGAAGG + Intergenic
1019491204 7:1314400-1314422 CAGGCCCAAGAGCAGGTCGGAGG - Intergenic
1025190731 7:56893642-56893664 CTGTCCCAAGGCCAGCAGGAGGG + Intergenic
1025681212 7:63683282-63683304 CTGTCCCAAGGCCAGCAGGAGGG - Intergenic
1029490224 7:100866695-100866717 ACGTCCCAAGGGCAGGGCCACGG - Exonic
1031484753 7:122312852-122312874 GTGTCCCAAGGGGAGGTCGGGGG - Intergenic
1035811469 8:2495190-2495212 CTGCCCAAAGGGAAGGACGAGGG - Intergenic
1035854915 8:2964389-2964411 CTGGCCCAAGGGAATGTCCAGGG + Intronic
1039721023 8:40164384-40164406 CTGTCCGATTGGCAGGTCGTTGG + Intergenic
1041978931 8:63832860-63832882 CTGGCCCAAGGGCAGGAAGCTGG - Intergenic
1045564533 8:103299347-103299369 CTGTCCCGGGGGAAGGGCGAAGG - Intronic
1048967106 8:139623381-139623403 CTGTGCCAAGAGCAGGTCCCAGG - Intronic
1056526429 9:87447018-87447040 CTGTCCAATGGGCAGGTAGGAGG - Intergenic
1056664696 9:88572256-88572278 TTGTCCCAAGGGCAGGCACAAGG - Intronic
1056904500 9:90633459-90633481 CTGTCCCAAAGGCACTTGGAGGG - Intronic
1059413672 9:114149963-114149985 CTCTCCCCAGGGCAGGTGGCTGG - Intergenic
1059508496 9:114821733-114821755 CTGTCCCATTGGAAGGTCTATGG + Intergenic
1061330701 9:129890447-129890469 CTGTCCACAGGGCAGGGCGCTGG + Exonic
1203785907 EBV:127459-127481 CTGTCCCGATGGCAGGTGCACGG - Intergenic
1186515792 X:10165357-10165379 TCGTCCCCAGGGCAGGTCAAGGG - Intronic
1199668626 X:150121804-150121826 CTGTCAGAAGGGAAGGTCTAGGG - Intergenic