ID: 994030672

View in Genome Browser
Species Human (GRCh38)
Location 5:95138604-95138626
Sequence TTGGTTAGCAGACCTATTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994030672 Original CRISPR TTGGTTAGCAGACCTATTCC TGG (reversed) Intronic
903413361 1:23165197-23165219 TTGGGTAGCAGATTTATCCCTGG - Intronic
908351966 1:63294868-63294890 TTAGTTTGCACACCTATTTCAGG - Intergenic
915745291 1:158151666-158151688 TTGGTTAGCAGGACATTTCCAGG + Intergenic
916709490 1:167390970-167390992 TCGGTTAGCTGACAAATTCCAGG - Intronic
919422092 1:197382355-197382377 TTGGTTATCAAGTCTATTCCAGG - Intronic
921107117 1:211993043-211993065 CTGGTGACCAGTCCTATTCCAGG - Intronic
1062826768 10:575673-575695 TTGCTCAGCAGAACTGTTCCTGG + Intronic
1066365139 10:34769252-34769274 TTGGTAGGCAGACCTAGCCCTGG - Intronic
1069847531 10:71383084-71383106 TGGGTTAGGAGTCCTGTTCCAGG + Intergenic
1070805670 10:79269361-79269383 TTGCTTCGCAGGCCTCTTCCTGG + Intronic
1073769011 10:106714937-106714959 GTGGTTTGAAGACCTCTTCCGGG - Intronic
1076512714 10:131023850-131023872 TTTCTTAGCAGACGTATTTCTGG - Intergenic
1077806765 11:5598003-5598025 CTAGTTAGCAGACCTTTTTCAGG + Intronic
1079466179 11:20733099-20733121 TTGGATAGCAGCCATATACCAGG - Intronic
1080208363 11:29756520-29756542 GTGGAAAGCAGACATATTCCTGG - Intergenic
1080679264 11:34458814-34458836 TTGCTTTGCAGTCCTTTTCCCGG - Intronic
1081444077 11:43113067-43113089 TTGGTGCCCAGACCTACTCCTGG + Intergenic
1087263451 11:96036466-96036488 GTGGTGACCAGACCTGTTCCAGG - Intronic
1087340885 11:96905345-96905367 TTGTTTAGAAGAACTATTTCGGG + Intergenic
1097715064 12:62957350-62957372 TTAGTCAGCAGCCCAATTCCAGG + Intergenic
1098681736 12:73364664-73364686 GTGTTTAGCAAACCTATTTCTGG + Intergenic
1099450334 12:82800300-82800322 TTGGGAAACAGGCCTATTCCAGG + Intronic
1104698773 12:130885051-130885073 TTGGTCAGCATGCCTTTTCCTGG + Intergenic
1107526145 13:41233674-41233696 ACGGTGAGCAGACCTATTCAGGG - Intronic
1109118292 13:58418880-58418902 TAGTTTAGCAGACATATTCAAGG - Intergenic
1118234947 14:63994026-63994048 TTGGTTGTCAGAGCCATTCCTGG + Intronic
1120011208 14:79417167-79417189 TTGCATATCATACCTATTCCTGG - Intronic
1122595278 14:102886087-102886109 ATGGTGAGCAGAGCCATTCCTGG + Intronic
1125486899 15:40117479-40117501 TAGGTTATGAGATCTATTCCAGG + Intergenic
1127839646 15:62820033-62820055 TTGGTGAGAAGACCTTTCCCAGG - Intronic
1133530026 16:6646782-6646804 TTGCTTAGCAGACAAATTCAAGG + Intronic
1138616008 16:58167657-58167679 CTTGTTAGCAGAGCTATTCTGGG - Intronic
1140505935 16:75472802-75472824 TGGGTTCTCTGACCTATTCCAGG + Exonic
1145118604 17:20235138-20235160 TTGGTTAGCTGACCTTTCCCTGG + Intronic
1145170729 17:20654255-20654277 TTGGTCAGCTGACCTTTCCCTGG + Intergenic
1145255840 17:21321923-21321945 TTGCTAAGCAGTCCTATCCCAGG + Intergenic
1145320779 17:21766023-21766045 TTGCTAAGCAGTCCTATCCCAGG - Intergenic
1148062776 17:44848145-44848167 TCTGTTAGCAGACATAATCCTGG - Exonic
1148873785 17:50674663-50674685 TTGGCTCACAGACCTTTTCCTGG + Intronic
1149348012 17:55758251-55758273 TTGATTAGAAGCCCTATTCAAGG - Intronic
1151090787 17:71438075-71438097 TGGGTTAGGATACCTATTCAGGG - Intergenic
1151346012 17:73501714-73501736 TTTGTTATCAGATCTGTTCCAGG + Intronic
1152018346 17:77766749-77766771 TTGGTTAGGAGCACTCTTCCTGG + Intergenic
1153468393 18:5415587-5415609 GTGGGTAGCAGAACGATTCCGGG + Intronic
1155339733 18:24801852-24801874 ATGGTCTGCAGGCCTATTCCTGG - Intergenic
1155769966 18:29683949-29683971 TTGGTGTGCAGCCCTATTTCTGG - Intergenic
1158083520 18:53622877-53622899 TTGCTTAGTATACCTCTTCCTGG + Intergenic
1166164936 19:40980768-40980790 TCCCTTAGCAGACCTCTTCCTGG + Intergenic
925129015 2:1481434-1481456 TCAGATAGCAGACCTATTTCTGG + Intronic
932146410 2:69322654-69322676 TTGGTTAAGAGAGCTATTACAGG - Exonic
932275768 2:70451203-70451225 TTGGTGGGCAGCCCTAGTCCAGG + Intronic
932357612 2:71079171-71079193 CTCGGTAGCTGACCTATTCCTGG + Intronic
937300257 2:120834695-120834717 TTTGTTCACAGACCTTTTCCTGG + Intronic
945947846 2:216011580-216011602 TGGGTGAGCAGACTCATTCCAGG + Intronic
1172504671 20:35452866-35452888 GTGGATAGGAGACTTATTCCTGG - Intronic
958940051 3:100301621-100301643 TTGTTTATCAGCACTATTCCAGG - Intronic
962349967 3:134649576-134649598 TTAGTTATCAGACCTACTCTTGG - Intronic
964219468 3:154327206-154327228 TTGGTTTACAGAGCTATTCCTGG - Intergenic
970106656 4:12593516-12593538 TGTGTTAGAAGACCTGTTCCAGG - Intergenic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
982074561 4:151725631-151725653 TTGCTTAGCAAACCCTTTCCTGG - Intronic
983191511 4:164759199-164759221 TTGGATATCAGAACTAATCCAGG + Intergenic
994030672 5:95138604-95138626 TTGGTTAGCAGACCTATTCCTGG - Intronic
1000801818 5:165737126-165737148 CTGGTTAGCAGACCAGTTCTTGG + Intergenic
1016255782 6:142103423-142103445 TTGGTTATCAAACTCATTCCTGG - Intergenic
1022557659 7:31315598-31315620 GTGGTTAGTAGGACTATTCCAGG - Intergenic
1028223685 7:88225052-88225074 TTGCTTATCATGCCTATTCCAGG - Intronic
1032792980 7:135256030-135256052 TTGGTTAGGAGGGCCATTCCTGG + Intronic
1037250335 8:16886063-16886085 TTAGTGAGCAGACCTCTTGCTGG + Intergenic
1041100408 8:54391200-54391222 CTGCTGAGCAGACCTAATCCAGG - Intergenic
1049529227 8:143146127-143146149 CTGGTGAGCAGGCCTATTTCTGG + Intergenic
1051859022 9:21603050-21603072 TTGGATAGCCGAACTATTCCTGG + Intergenic
1056006984 9:82283468-82283490 TTGGGTAGGAGAGCTATTCTTGG + Intergenic
1186171201 X:6878924-6878946 TTGCTTAGAAGGCCGATTCCTGG + Intergenic
1192875556 X:75225713-75225735 TGGGTTAGCAGAGCTACTCATGG + Intergenic
1195503234 X:105627710-105627732 TTTGATATCAGATCTATTCCTGG + Intronic
1200905661 Y:8479585-8479607 TTGGTTTGCTGACCTCTCCCAGG - Intergenic