ID: 994038125

View in Genome Browser
Species Human (GRCh38)
Location 5:95225956-95225978
Sequence CATCCATCTCTTAGGGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994038125_994038129 19 Left 994038125 5:95225956-95225978 CCCTATTCCCTAAGAGATGGATG 0: 1
1: 0
2: 0
3: 11
4: 104
Right 994038129 5:95225998-95226020 TTTATTTTTTAAATTTCCACAGG 0: 1
1: 1
2: 28
3: 292
4: 1812
994038125_994038133 28 Left 994038125 5:95225956-95225978 CCCTATTCCCTAAGAGATGGATG 0: 1
1: 0
2: 0
3: 11
4: 104
Right 994038133 5:95226007-95226029 TAAATTTCCACAGGTGTTGGGGG 0: 1
1: 0
2: 3
3: 55
4: 402
994038125_994038132 27 Left 994038125 5:95225956-95225978 CCCTATTCCCTAAGAGATGGATG 0: 1
1: 0
2: 0
3: 11
4: 104
Right 994038132 5:95226006-95226028 TTAAATTTCCACAGGTGTTGGGG No data
994038125_994038131 26 Left 994038125 5:95225956-95225978 CCCTATTCCCTAAGAGATGGATG 0: 1
1: 0
2: 0
3: 11
4: 104
Right 994038131 5:95226005-95226027 TTTAAATTTCCACAGGTGTTGGG 0: 1
1: 0
2: 9
3: 140
4: 939
994038125_994038130 25 Left 994038125 5:95225956-95225978 CCCTATTCCCTAAGAGATGGATG 0: 1
1: 0
2: 0
3: 11
4: 104
Right 994038130 5:95226004-95226026 TTTTAAATTTCCACAGGTGTTGG 0: 1
1: 0
2: 6
3: 62
4: 524

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994038125 Original CRISPR CATCCATCTCTTAGGGAATA GGG (reversed) Intronic
902466177 1:16620113-16620135 CCTCCATCTCTGAGGGTATGGGG - Intergenic
902508513 1:16953190-16953212 CCTCCATCTCTGAGGGTATGGGG + Intronic
904632066 1:31849686-31849708 CATCCGTCTTTAAGAGAATAGGG - Intergenic
908553642 1:65234784-65234806 CATCCCTCTCTCAGGTTATATGG - Intergenic
911130712 1:94384906-94384928 TCTCCATCTCTTAGGGACTTTGG - Intergenic
911280062 1:95913674-95913696 CTCCCATCTCTCAGGGATTATGG - Intergenic
913182222 1:116333411-116333433 GAAGAATCTCTTAGGGAATAGGG + Intergenic
915029607 1:152866635-152866657 CATCTATCTACAAGGGAATAGGG + Intergenic
915709031 1:157875719-157875741 CATCCACCTCTTTGTGGATAGGG + Intronic
916315651 1:163445323-163445345 AAACCATCTCATAGGGAATTAGG + Intergenic
924689325 1:246330531-246330553 CATCCATCTGTGAAGGAAAAGGG + Exonic
1063370507 10:5518850-5518872 CATGGATCTCTTTGGGAATAGGG + Intergenic
1070584525 10:77752214-77752236 CATCCAACTCCTAGGAATTATGG + Intergenic
1073057088 10:100709877-100709899 CATCCACTTCTCAGGGAACAGGG + Intergenic
1076516473 10:131047821-131047843 CACCCATTTATTAGGGAAGAGGG + Intergenic
1078079356 11:8192840-8192862 CATCCAGCTCTTTGGCAAGAAGG - Intergenic
1079082217 11:17421675-17421697 CATCAATCTCATGGGTAATAAGG + Intronic
1082681032 11:56170687-56170709 CTTCCATTTCTTAGTGAATAGGG + Intergenic
1082991603 11:59211689-59211711 CACTCAGCTCTCAGGGAATAGGG - Exonic
1087867189 11:103245301-103245323 CATCCATCTCTTGTATAATAAGG - Exonic
1087949230 11:104199745-104199767 CAACCATCTTTTAAGGACTAAGG + Intergenic
1093029056 12:14271510-14271532 CCACCATATCTTAGGGAAAATGG - Intergenic
1095296085 12:40529282-40529304 CATGGATTTCTTAGGGAAAATGG + Intronic
1095587937 12:43869272-43869294 CATCCTTCTCTTAAGCAAAAGGG + Intronic
1096599946 12:52722119-52722141 CATAGATCTCTTGGGGATTAAGG - Intergenic
1097237967 12:57552592-57552614 CATTCATCATTTAGGGAATGAGG + Intronic
1101457015 12:104844035-104844057 AATCCATCTCTTAAGGGATTAGG + Intronic
1101489673 12:105199315-105199337 CAGCCACCTCTTAGGGAAAACGG + Intronic
1102656690 12:114487961-114487983 CATCCACCTCCCAGGCAATATGG - Intergenic
1102682950 12:114702862-114702884 CCTCCAGCCCTTGGGGAATATGG + Intergenic
1104612331 12:130239558-130239580 CATCCCACACTTAGGGAATAGGG - Intergenic
1106298206 13:28437701-28437723 ACTTCATCTCTTAGGGAAAAAGG - Intronic
1112157532 13:96833858-96833880 CTTCCATCTTTTAGGGAACGGGG + Exonic
1112536768 13:100265806-100265828 CATCCATCTATTAGAAAATCTGG - Intronic
1115440108 14:33424693-33424715 AATCCATAAGTTAGGGAATATGG + Intronic
1116047894 14:39766426-39766448 CATCCATTGTTTAGGGAACAGGG + Intergenic
1117282892 14:54258015-54258037 CATCCATCTCCCAGGGCAAAAGG - Intergenic
1120291883 14:82584773-82584795 CATCCATCTGTTAGGACAAAAGG - Intergenic
1121807953 14:96848522-96848544 CATGCCTCTCTTAGGGAGTGTGG + Intronic
1122564739 14:102644915-102644937 CAGCCATTTCTTAGGGAAAAGGG - Intronic
1124864446 15:33475278-33475300 CATCCATCGAGTAGGGTATAGGG + Intronic
1127208863 15:56750023-56750045 CATCCATCCCTAAGGGGATTGGG + Intronic
1129648803 15:77464587-77464609 TATACATTTCTTAGGGAACAGGG - Intronic
1131352289 15:91712363-91712385 CATCCGTGTCTGAGGCAATAGGG + Intergenic
1133580472 16:7139827-7139849 CATTCATGTCTTAAGGAATGAGG + Intronic
1137899035 16:52245212-52245234 CATCCATCAGTTATTGAATAAGG + Intergenic
1140168456 16:72578798-72578820 CATCCACATCTCAGGTAATAAGG - Intergenic
1147890288 17:43712103-43712125 GACAAATCTCTTAGGGAATATGG - Intergenic
1148087531 17:45003372-45003394 CATCCATCTCTTTGGGCCTCTGG + Intergenic
1149560225 17:57603268-57603290 CATGCATCTCTTGGGGTAAAGGG + Intronic
1158709124 18:59821455-59821477 CTTCCAGCTCTTAGGGAAATGGG + Intergenic
1164294852 19:23900891-23900913 CATCCATCACCTATGAAATAGGG + Intergenic
1165909731 19:39218038-39218060 GTTATATCTCTTAGGGAATAAGG - Intergenic
925215536 2:2092270-2092292 TATGCTTGTCTTAGGGAATAGGG + Intronic
931288566 2:60853094-60853116 AGACCAGCTCTTAGGGAATATGG + Intergenic
932131792 2:69194310-69194332 CATCCATTTCTTTGGGAATCAGG + Intronic
933875785 2:86620699-86620721 AATCCATCTCTTATAGAACAGGG + Intronic
941370690 2:164659710-164659732 CTGCCATCTTTTAGGGAATAAGG + Intronic
942997228 2:182277334-182277356 CAGCCAACACTTAGGGAAAATGG + Intronic
944850034 2:203709470-203709492 CATCCAACTCATAAGGAATCAGG - Intronic
947670542 2:231932914-231932936 TATCCATCCCTGAGGGAAGAAGG - Intergenic
1174941427 20:54933102-54933124 CGTCAATCTCTAAGGGAAAAGGG + Intergenic
1177115929 21:17087249-17087271 CTGCCATCTATTTGGGAATATGG - Intergenic
1180714606 22:17863321-17863343 AATCCATCTCTGATGAAATAGGG + Intronic
955924631 3:63993223-63993245 CAGCCCCTTCTTAGGGAATATGG - Intronic
957784280 3:84861033-84861055 CAACATTCTCTTAGGGAAGAAGG + Intergenic
958644566 3:96852907-96852929 CATCCATTTCTTTGTAAATAAGG + Intronic
959217679 3:103473520-103473542 TATCCATCTCTTTTAGAATATGG - Intergenic
964690279 3:159442463-159442485 CTTCCAGGCCTTAGGGAATAAGG + Intronic
965359848 3:167725294-167725316 CATCAAACTCTTAGAGAAAATGG + Intronic
965906615 3:173715421-173715443 CACCCATCACTTATGGAACAAGG - Intronic
972000254 4:34022724-34022746 CCTCCATCTTCTTGGGAATATGG - Intergenic
972262131 4:37419820-37419842 CAAACATCTCTTATAGAATAAGG + Intronic
974863683 4:67553784-67553806 CATGCCTTCCTTAGGGAATAAGG - Intergenic
975054595 4:69914123-69914145 CATCCAACTTTTTGGAAATATGG + Intergenic
977344687 4:95802853-95802875 AATCCATCACTTAGGTATTAAGG + Intergenic
992251037 5:74876222-74876244 CATCCATCTCAAAGGGACAAAGG + Intergenic
994038125 5:95225956-95225978 CATCCATCTCTTAGGGAATAGGG - Intronic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
995658906 5:114458976-114458998 CATCACTCTCTTGGGGAAGAAGG + Intronic
996856929 5:128018856-128018878 CATCCATCCCTTAGGTGATATGG - Intergenic
999293686 5:150444470-150444492 CATCCATCTGTTAGGTACTGGGG - Intronic
999568824 5:152895666-152895688 CATTCATCTCCTAGTGAAGAGGG - Intergenic
999844532 5:155464347-155464369 CTTCCATATCTTTGGGAATAAGG - Intergenic
1001873657 5:175180601-175180623 CAATCATTTCTAAGGGAATAAGG - Intergenic
1002940622 6:1712326-1712348 CATCCTTCACTTAGGAGATAGGG + Intronic
1006517786 6:34554365-34554387 CAACCAAGTCTGAGGGAATAGGG - Intronic
1011500224 6:87979992-87980014 CATCCAAGTCATAGGGAATGGGG + Intergenic
1015754893 6:136597190-136597212 AAGCTATCTCTTAGGGGATATGG - Intronic
1020821863 7:12979984-12980006 AATCCATCTCTTAGATAATATGG + Intergenic
1021860272 7:24899111-24899133 CATCCATTTCTTATGGGACATGG + Intronic
1029612891 7:101636779-101636801 CAGGCATCCCTTAGGGAATGGGG - Intergenic
1034485206 7:151356547-151356569 GATCCATCCCTTAGGGGACAAGG - Intronic
1035544530 8:469332-469354 CATTCTTGTCTTAGGGATTATGG + Exonic
1037316760 8:17606584-17606606 CACCCATCTCTGGGGAAATACGG - Intronic
1038626202 8:29195648-29195670 CCTCTGTCTCTTAGGGAATGTGG - Intronic
1041793358 8:61720930-61720952 CAGTAATCACTTAGGGAATATGG + Intergenic
1043551326 8:81376206-81376228 CATCCATCCCTTCTGGAATAGGG - Intergenic
1044893792 8:96865919-96865941 CATGCCTGTCTTAGGGAGTAAGG + Intronic
1045120766 8:99031767-99031789 CAGCCATTTCTCAGGGACTAAGG - Intronic
1048019907 8:130528403-130528425 CCTCCCTCTCTAAAGGAATATGG - Intergenic
1048156395 8:131958896-131958918 CATCCATTTCATAGGGTAAAAGG - Intronic
1048186153 8:132242890-132242912 CATAAATCTCTGAGAGAATAAGG + Intronic
1048413880 8:134204832-134204854 AATCCATCACCTAGGTAATAAGG + Intergenic
1050470319 9:5981743-5981765 CGTCCATCTCTTCTGGAAAATGG + Intronic
1050483723 9:6112680-6112702 CATACATTTCTCAGTGAATAGGG - Intergenic
1051191116 9:14514635-14514657 CAGCCATCTCTCAAGCAATATGG - Intergenic
1051191833 9:14521069-14521091 CATCCACCACTTTGTGAATAGGG - Intergenic
1051500124 9:17767667-17767689 CATCCTTCACTTAAAGAATAAGG + Intronic
1051521491 9:17993830-17993852 CATCCATCTCTTGTGGGATTTGG + Intergenic
1053361185 9:37487696-37487718 CCACTATCTCTAAGGGAATATGG - Intronic
1058114185 9:101066416-101066438 CATCCCCCTCTTAAGGAATGGGG + Intronic
1186450019 X:9664413-9664435 CATCCATTTCTCAGTTAATAGGG - Intronic
1188911867 X:35859159-35859181 CATCACTTTCCTAGGGAATATGG + Intergenic
1192139918 X:68638603-68638625 CTTCCATCTCTCAGGGCATCTGG + Intergenic
1201534760 Y:15034342-15034364 GATCCATCTCATTGGGCATAAGG + Intergenic