ID: 994041965

View in Genome Browser
Species Human (GRCh38)
Location 5:95268875-95268897
Sequence CTTTCATCCATCGCTGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 8, 2: 10, 3: 64, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994041961_994041965 20 Left 994041961 5:95268832-95268854 CCTTAGCTGCACTGAGAGGCAAA 0: 1
1: 3
2: 7
3: 28
4: 214
Right 994041965 5:95268875-95268897 CTTTCATCCATCGCTGGGTCAGG 0: 1
1: 8
2: 10
3: 64
4: 211
994041960_994041965 21 Left 994041960 5:95268831-95268853 CCCTTAGCTGCACTGAGAGGCAA 0: 1
1: 3
2: 4
3: 21
4: 162
Right 994041965 5:95268875-95268897 CTTTCATCCATCGCTGGGTCAGG 0: 1
1: 8
2: 10
3: 64
4: 211
994041959_994041965 22 Left 994041959 5:95268830-95268852 CCCCTTAGCTGCACTGAGAGGCA 0: 1
1: 3
2: 6
3: 24
4: 159
Right 994041965 5:95268875-95268897 CTTTCATCCATCGCTGGGTCAGG 0: 1
1: 8
2: 10
3: 64
4: 211
994041962_994041965 -6 Left 994041962 5:95268858-95268880 CCTGTGTCAGTGTATGTCTTTCA 0: 2
1: 1
2: 7
3: 19
4: 207
Right 994041965 5:95268875-95268897 CTTTCATCCATCGCTGGGTCAGG 0: 1
1: 8
2: 10
3: 64
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994041965 Original CRISPR CTTTCATCCATCGCTGGGTC AGG Intronic
901202606 1:7475286-7475308 CTGCCATCTATCGCTGGGGCAGG + Intronic
902084098 1:13844362-13844384 CTTTCATCCATCACTAGGTCAGG - Intergenic
902795156 1:18796091-18796113 CTGACATCCATCACGGGGTCAGG + Intergenic
909323939 1:74325323-74325345 CTTTCATCCATCGCTCAGCCAGG + Intronic
909523374 1:76595064-76595086 CTTTCATCCATTGCTCGGCCAGG - Intronic
910831727 1:91468166-91468188 CTGTCATCCATTGCTGGGTCAGG + Intergenic
911175483 1:94813262-94813284 CTCTCATTCGTTGCTGGGTCAGG + Intergenic
911972134 1:104452271-104452293 CTTTCAGCCATGGCTGGAGCTGG - Intergenic
915815268 1:158959173-158959195 TATTCATCCGTCGTTGGGTCAGG - Intronic
916649325 1:166820157-166820179 CTTTTATCCATAGCTGGAGCTGG + Intergenic
917080295 1:171251359-171251381 TATTCATCCATTGCTGGGTCAGG + Intronic
918074589 1:181160736-181160758 TATTCATCCATCGTTGGGTCAGG + Intergenic
919175140 1:194010330-194010352 CTTTCAGCCATGGCTGGAGCAGG - Intergenic
920372971 1:205491372-205491394 CTGGCATCCCTCCCTGGGTCTGG + Intergenic
922075674 1:222241626-222241648 TATTCATCCGTCCCTGGGTCAGG + Intergenic
922466964 1:225851019-225851041 CTTTCATCCGTCGCTGGGTCAGG + Intronic
924259704 1:242216748-242216770 CTCTCATCCATCACTGAGTTAGG + Intronic
1064191844 10:13213300-13213322 CTTTCATCCATCGCTCAGCCTGG - Intergenic
1067096723 10:43306147-43306169 TATTCATCCATCCTTGGGTCAGG - Intergenic
1069205337 10:65675611-65675633 CTTTCATCTGTCGCTCGGTCAGG + Intergenic
1080941637 11:36925010-36925032 CCTTCTTCCACCACTGGGTCTGG + Intergenic
1081432938 11:42996516-42996538 CTTTCATCAATCCCAGGGTCTGG + Intergenic
1083084158 11:60125184-60125206 CATTCATCCGTCGCTCAGTCAGG + Intergenic
1083588895 11:63880798-63880820 TTTTCATCCATCACTGGGATAGG + Intronic
1084255981 11:67943082-67943104 CTTTCTTCCAAAGCTGGGCCTGG + Intergenic
1084816780 11:71652232-71652254 CTTTCTTCCAAAGCTGGGCCTGG - Intergenic
1085455321 11:76662182-76662204 CTTTCTTCCCAGGCTGGGTCAGG + Intronic
1086173984 11:83868174-83868196 CTTCCTTCCATCCCTGGGTGGGG - Intronic
1086238745 11:84663343-84663365 CTTTGATCCAGCCTTGGGTCAGG - Intronic
1087060626 11:93973551-93973573 TTTTCATCCATCGTTTGGCCAGG + Intergenic
1087215453 11:95488356-95488378 CTCTCATCCATCGCTGGGTCAGG + Intergenic
1087499616 11:98933366-98933388 TTTTCATCCATCGCTCTGTCAGG - Intergenic
1088903505 11:114136646-114136668 CTTTCATTCATCTCTTGGTGGGG - Intronic
1090133236 11:124167926-124167948 CATTCATCCGTTGCTGGGTCAGG - Intergenic
1092426212 12:8377821-8377843 CTTTCTTCCAAAGCTGGGCCTGG + Intergenic
1092450171 12:8594240-8594262 CTTTCATCCATCGCTCGGCCAGG - Intergenic
1093171259 12:15863365-15863387 CATTCATCCGTCGTGGGGTCAGG - Intronic
1096534522 12:52262707-52262729 TATTCATCCATCATTGGGTCAGG - Intronic
1098711600 12:73769692-73769714 CTTTCATCTGCCGCTTGGTCAGG + Intergenic
1099526683 12:83725726-83725748 TATTCATCCATCACTGGGTCAGG + Intergenic
1104153489 12:126107740-126107762 CATTAATCCGTCGTTGGGTCAGG - Intergenic
1104344109 12:127980437-127980459 TATTCATCCGTCGCTGGGTCAGG + Intergenic
1105203024 13:18195151-18195173 CTTTCTTCCACCCCTGGGGCTGG + Intergenic
1105256765 13:18748550-18748572 CTTTCAGCCATGGCTGGAGCTGG + Intergenic
1105258100 13:18758281-18758303 CTTTCAACCATGGCTGGAGCTGG + Intergenic
1105258553 13:18761508-18761530 CTTTCATCCGTGGCTGGAGCAGG + Intergenic
1105259439 13:18767911-18767933 CTTTCAGCCATGGCTGGAGCTGG + Intergenic
1105260758 13:18777587-18777609 CTTTCAACCATGGCTGGAGCTGG + Intergenic
1105261221 13:18780809-18780831 CTTTCATCCGTGGCTGGAGCAGG + Intergenic
1105262117 13:18787232-18787254 CTTTCAGCCATGGCTGGAGCTGG + Intergenic
1105263546 13:18797404-18797426 CTTTCATCCATGGCTGGAGCTGG + Intergenic
1105264469 13:18803810-18803832 CTTTCAGCCATGGCTGGTGCTGG + Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1107079198 13:36356358-36356380 TATTCATCCATCATTGGGTCAGG + Intronic
1108287949 13:48927379-48927401 CTTTCATCTTTCTCTGGTTCTGG + Intergenic
1108451807 13:50574775-50574797 CTTTCCTACATCTCAGGGTCAGG - Intronic
1110411179 13:75205118-75205140 CTTTCAGCCATGGCTGGTGCTGG + Intergenic
1112055252 13:95684765-95684787 CTTTCAGCCATGGCTGGAGCTGG - Intronic
1112158901 13:96848304-96848326 CATTCATCCGTCGCTGGGTCAGG - Intergenic
1113927702 13:113950727-113950749 CTTTCTCCCACAGCTGGGTCTGG + Intergenic
1120101533 14:80450644-80450666 CTTTTAGCCATGGCTGGGGCTGG - Intergenic
1120103864 14:80472998-80473020 TATTCATCCATCATTGGGTCAGG + Intergenic
1120225078 14:81781816-81781838 CTTTCATCTGTCGCTGGTTCAGG - Intergenic
1120694745 14:87632158-87632180 CTTTCATCCAACGATGAGACTGG - Intergenic
1122504785 14:102225574-102225596 CTGTCACCCTTCGCTGGTTCTGG + Intronic
1202834890 14_GL000009v2_random:70636-70658 CTTTCATCCATGGCTGGAGCTGG - Intergenic
1123984265 15:25630988-25631010 CTTGGATCCATCACTGGGTGTGG - Intergenic
1126379536 15:48031643-48031665 CCTTCCCCCATCGCTGGCTCAGG + Intergenic
1128321978 15:66701043-66701065 CTTTCATTCAGCGCGGGGCCAGG + Intergenic
1131006094 15:88979672-88979694 TATTCATCCATTGTTGGGTCAGG - Intergenic
1131050751 15:89346321-89346343 CTCTTTTCCATCCCTGGGTCTGG + Intergenic
1131937148 15:97519296-97519318 CTTTCCTCCATCAGTGGCTCAGG + Intergenic
1135107431 16:19662394-19662416 CTTTTATCCGTCACTGGGTCAGG - Intronic
1135596022 16:23743975-23743997 CATTCATCCAGCGCTGTTTCAGG - Intergenic
1136520556 16:30792926-30792948 TATTCATCCATCGCCAGGTCAGG - Intergenic
1143678626 17:8458345-8458367 GTTTCATCCACCCCTGGGTGTGG + Intronic
1145069997 17:19796764-19796786 TTTTCATCCATTACTTGGTCAGG + Intronic
1147882966 17:43665651-43665673 CTTCCATCCATCTCTGTCTCTGG - Intergenic
1151799242 17:76368008-76368030 TATTCATCCGTCGTTGGGTCAGG + Intronic
1151861063 17:76762343-76762365 TATTCATCCATTGTTGGGTCAGG - Intronic
1154424804 18:14263999-14264021 CTTTCATCCATGGCTGGAGCTGG - Intergenic
1154425254 18:14267204-14267226 CTTTCAACCATGGCTGGAGCTGG - Intergenic
1154426574 18:14276885-14276907 CTTTCAGCCATGGCTGGAGCTGG - Intergenic
1154427487 18:14283334-14283356 CTTTCATCCATAGCTGGAGCTGG - Intergenic
1154427988 18:14286792-14286814 CTTTCAGCCATGGCTGGAGCTGG - Intergenic
1154429317 18:14296477-14296499 CTTTCAGCCATGGCTGGAGCTGG - Intergenic
1154430214 18:14302870-14302892 CTTTCATCCATGGCTGGAGCTGG - Intergenic
1154430700 18:14306302-14306324 CTTTCAGCCATGGCTGGAGCTGG - Intergenic
1154432494 18:14319222-14319244 CTTTCATCCATGGCTGGAGCTGG - Intergenic
1154432950 18:14322443-14322465 CTTTCAACCATGGCTGGAGCTGG - Intergenic
1156280973 18:35638237-35638259 CGTTCATCCATCGCTTGGTCGGG - Intronic
1156400208 18:36732860-36732882 CTCTCATCCGTCACTGGGTTAGG - Intronic
1156891110 18:42190201-42190223 CTTTCATCCCTCACTTGGCCAGG + Intergenic
1157719326 18:49911750-49911772 TATTCATCCATTGCTGGGTCAGG + Intronic
1158171702 18:54607010-54607032 CTTTCATCCATCGCTCAGCCAGG - Intergenic
1159890899 18:73952272-73952294 CTCTCATCCATCACTGTGTTGGG + Intergenic
1161826252 19:6567964-6567986 CTTTCATCCATCACTGGGTCAGG - Intergenic
1162271272 19:9617824-9617846 CTTTCTTACATTGCTGGGTGCGG - Intronic
1162276419 19:9659112-9659134 CTTTCTTACATTGCTGGGTGCGG - Intronic
1162916053 19:13874947-13874969 CATTCATCCCCCGGTGGGTCTGG - Intronic
1164011833 19:21210433-21210455 CTTTCATCCATCACTGTGTCAGG + Intergenic
1164259705 19:23558868-23558890 TATTCATCCATCGTTGGGTCAGG + Intronic
1164993521 19:32702035-32702057 TATTCATCCATCATTGGGTCAGG - Intronic
1165774924 19:38398903-38398925 CTCTCACCCATCCCAGGGTCTGG - Intergenic
1165908455 19:39208451-39208473 CTGTCCTCCATCCCTGTGTCTGG - Intergenic
1166427924 19:42696520-42696542 TGTTCATCCGTTGCTGGGTCAGG + Intronic
1168537947 19:57186971-57186993 CTTTCATCCATCGCTCAGCCAGG - Intergenic
1202637815 1_KI270706v1_random:57056-57078 CTTTCATCTATGGCTGGGGCTGG + Intergenic
1202638704 1_KI270706v1_random:63434-63456 CTTTCAGCCATGGCTGGTGCTGG + Intergenic
925356117 2:3242466-3242488 CTTCCAGCCATCGGTGGGTGTGG - Intronic
926260211 2:11253158-11253180 CTTTCTTCCATCGCTGAATAGGG - Intronic
929688145 2:44052213-44052235 CTTTCATCCATAGCTGTGCCTGG - Intergenic
933418797 2:82022475-82022497 CTTTCAGCCATGGCTGGAGCGGG + Intergenic
933869994 2:86556858-86556880 CTTTCATCCGTCGTTTGGCCAGG + Intronic
934492272 2:94769510-94769532 CTTTCAGCCATGGCTGGAGCTGG + Intergenic
934493229 2:94776548-94776570 CTTTCAGCCATGGCTGGAGCTGG + Intergenic
934537141 2:95144183-95144205 TATTCATCCATTGTTGGGTCAGG + Intronic
936597733 2:113865412-113865434 CTCTCATCCATCACTGGTTCAGG + Intergenic
937789562 2:125943957-125943979 TATTCAACCATCGTTGGGTCAGG - Intergenic
938506801 2:131893012-131893034 ATTTCATCAATCACAGGGTCTGG - Intergenic
941843585 2:170112447-170112469 CTTTCATCCATCACTTGGCCAGG + Intergenic
941844499 2:170119741-170119763 CTTTCATCCATCGTTCAGCCAGG + Intergenic
943395530 2:187328649-187328671 CTTTTATCCATGGCTGGGGATGG - Intergenic
943480454 2:188411224-188411246 TATTCATCCATCGTTGGGTCAGG + Intronic
943619795 2:190136276-190136298 CTTTCATCCATTGCTGGGCCAGG - Intronic
943948064 2:194092858-194092880 CATTCACCCACCGTTGGGTCAGG - Intergenic
944037041 2:195307696-195307718 TATTCATCCATAGTTGGGTCAGG - Intergenic
947555662 2:231091019-231091041 CTTTCATCTATCACTCGGCCAGG - Intronic
947683503 2:232058825-232058847 CTTTCTTACATCACTGAGTCAGG - Intronic
948396015 2:237645558-237645580 TTTTCATCCATGTCAGGGTCCGG - Intronic
1169627811 20:7592232-7592254 CTTTCATCCATTGCTTGGCCAGG + Intergenic
1171194688 20:23187718-23187740 CTTCCATCTCTTGCTGGGTCTGG - Intergenic
1171883910 20:30637727-30637749 CTTTCAGCCATGGCTGGAGCTGG + Intergenic
1171884384 20:30641148-30641170 CTTTCATCCATGGCTGGAGCTGG + Intergenic
1171885296 20:30647554-30647576 CTTTCAGCCATGGCTGGTGCTGG + Intergenic
1172905344 20:38364942-38364964 CTTTCTCCCATGGCTGGGTGTGG + Intronic
1173396613 20:42686304-42686326 CTTCCATCCCTCACTGGGTAAGG - Intronic
1176714935 21:10342854-10342876 CTTTCGTCCACCCCTGGGGCTGG - Intergenic
1176785889 21:13255403-13255425 TATTCATCTATCGTTGGGTCAGG - Intergenic
1176786834 21:13267290-13267312 ATTTCATCAATCACAGGGTCTGG + Intergenic
1176844101 21:13863313-13863335 CTTTCAACCATGGCTGGAGCTGG + Intergenic
1176844544 21:13866527-13866549 CTTTCATCCATGGCTGGAGCTGG + Intergenic
1176846778 21:13882636-13882658 CTTTCAGCCATGGCTGGAGCTGG + Intergenic
1176847277 21:13886090-13886112 CTTTCATCCATGGCTGGAGCTGG + Intergenic
1176849092 21:13899101-13899123 CTTTCAGCCATGGCTGGAGCTGG + Intergenic
1176849547 21:13902252-13902274 CTTTCAGCCATGGCTGGTGCTGG + Intergenic
1177985439 21:27969365-27969387 ATTTCATCAATCACAGGGTCTGG + Intergenic
1180363263 22:11918455-11918477 CTTTCAGCCATGGCTGGTGCTGG - Intergenic
1180603413 22:17037084-17037106 CTTTCGTCCACCCCTGGGGCTGG + Intergenic
1184748648 22:46471841-46471863 CTTCCAGCCTTCCCTGGGTCTGG + Intronic
950727648 3:14927556-14927578 CTTTATTCCATCGCTGGAACAGG - Intronic
957070890 3:75567125-75567147 CTTTCTTCCAAAGCTGGGCCTGG + Intergenic
961283226 3:125779612-125779634 CTTTCTTCCAAAGCTGGGCCTGG - Intergenic
963692731 3:148525266-148525288 CTTTCATCTGTCGTTGGGTCAGG - Intergenic
966167382 3:177035744-177035766 TATTCATCCATTGCTGGGTCAGG - Intronic
967626287 3:191688767-191688789 TATTCATCCATCACTGGGTCAGG - Intergenic
969014497 4:4094802-4094824 CTTTCTTCCAAAGCTGGGCCTGG + Intergenic
970426896 4:15954058-15954080 CTTTCATCTGTCGCTTGGCCAGG + Intergenic
971684482 4:29746860-29746882 CTTTTATCCATGGCTGGAGCTGG + Intergenic
972209125 4:36815548-36815570 TATTCATGCATCACTGGGTCAGG - Intergenic
973367573 4:49219998-49220020 CTTTCAGCCATGGCTGGAGCTGG + Intergenic
973368041 4:49223421-49223443 CTTTCATCCATGGCTGAAGCTGG + Intergenic
973368951 4:49229822-49229844 CTTTCAGCCATGGCTGGTGCTGG + Intergenic
973392092 4:49565593-49565615 CTTTCAGCCATGGCTGGTGCTGG - Intergenic
973393009 4:49572005-49572027 CTTTCATCCATGGCTGAAGCTGG - Intergenic
974248868 4:59359733-59359755 CTTTTGGCCATGGCTGGGTCTGG - Intergenic
974496264 4:62632175-62632197 TATTCATCCATCGTTTGGTCAGG + Intergenic
974640621 4:64625159-64625181 CTTTCATCCATCACTCGGCTGGG - Intergenic
975220007 4:71804131-71804153 CTTTCATCCATTGCTCAGCCAGG - Intergenic
975423758 4:74202011-74202033 TATTCATCCATCGTTGGGTCAGG - Intronic
976141959 4:82002251-82002273 CTTTTATCCATTGCTGGAGCTGG - Intronic
978944546 4:114479957-114479979 TATTCATCCGTCGCTGGGTCAGG + Intergenic
980997218 4:139791204-139791226 ATCTCATCCACCGCTGGGTATGG + Intronic
982207977 4:153011390-153011412 CTTTGAGCCATCGCTGGAGCTGG + Intergenic
983545156 4:168955683-168955705 CTTTGATCCATAGTTGGGGCAGG - Intronic
983862580 4:172726053-172726075 TATTCATCCATCGCTGAATCAGG - Intronic
984026590 4:174550462-174550484 TATTCATCCATCGTTGGGTCAGG - Intergenic
984078653 4:175215216-175215238 TATTCATCCATCGTTGGGTCAGG - Intergenic
984078833 4:175216621-175216643 TATTCATCCATCATTGGGTCAGG - Intergenic
1202765135 4_GL000008v2_random:142913-142935 CTTTCATCCATGGCTGGAGCTGG + Intergenic
1202766042 4_GL000008v2_random:149293-149315 CTTTCAGCCATGGCTGGTGCTGG + Intergenic
985679496 5:1248581-1248603 CTTTTATCCATGGCTGCATCAGG - Intergenic
988132395 5:27121478-27121500 TATTCATCCATCGGCGGGTCAGG + Intergenic
989495702 5:42109541-42109563 TATTCATCCATCGTTGGGTCAGG + Intergenic
992970606 5:82053092-82053114 CTCTCATACATTGCTGGGGCAGG - Intronic
994041965 5:95268875-95268897 CTTTCATCCATCGCTGGGTCAGG + Intronic
995206056 5:109482729-109482751 CTTTCATCCGTCACTGGGTCAGG - Intergenic
995575737 5:113531230-113531252 CTCTCATCCATCACTGGGTCAGG - Intronic
996253570 5:121369569-121369591 TATTCATCCCTCGCTGGGTCAGG - Intergenic
997058713 5:130476287-130476309 CTCTCATCTGTCACTGGGTCAGG - Intergenic
998713802 5:144857471-144857493 CTTCCTTCAGTCGCTGGGTCAGG + Intergenic
999344966 5:150809677-150809699 CATTCATCCATGGCTGGCTCAGG + Intergenic
999661061 5:153863265-153863287 TATTCATCCATCGTTGGGTCAGG + Intergenic
999901095 5:156087793-156087815 TGTTCCTCCATCCCTGGGTCTGG - Intronic
1001598609 5:172914609-172914631 CATTCATCCATTGCAGGGGCAGG - Intronic
1006280533 6:33049651-33049673 CTCTCATCCATTACTGGGTCAGG + Intergenic
1006310944 6:33258990-33259012 CATTCATCCGTTGCCGGGTCAGG - Intronic
1006861424 6:37174001-37174023 CTTGCATCCATGGATGGTTCTGG - Exonic
1007196576 6:40066647-40066669 CTTTGAACCATGGCTGGGGCTGG - Intergenic
1008510747 6:52273545-52273567 CTTTTGTCCATTTCTGGGTCTGG - Intronic
1011359064 6:86502361-86502383 CTTTCATCCATCACTCAGCCAGG - Intergenic
1011745913 6:90407544-90407566 TATTCATCCATTGTTGGGTCAGG - Intergenic
1013059826 6:106622748-106622770 CTCTCATCCGTCGCTGGATCAGG + Intronic
1014916240 6:127152295-127152317 CTTTCATTCAGGGCTGGCTCCGG + Intronic
1015559511 6:134499264-134499286 CTGTCATTCATTGATGGGTCAGG - Intergenic
1015900530 6:138060854-138060876 CATTCATCCATCGCTGGGTCAGG - Intergenic
1017868732 6:158468000-158468022 TATTCATCCGTTGCTGGGTCAGG - Intronic
1017985274 6:159438160-159438182 CTGTCAGCCATCACTGGGGCTGG + Intergenic
1019002605 6:168767768-168767790 CTTTTATACATTGCTGGATCTGG + Intergenic
1026559548 7:71436896-71436918 TATTCATCCATTGTTGGGTCAGG - Intronic
1028648202 7:93121122-93121144 CTTAGATCCATCGCTCGGCCAGG - Intergenic
1029694294 7:102202813-102202835 CTATCATCCTTCCCTGGCTCAGG + Intronic
1031707541 7:124999576-124999598 CTTTCATTCATCTCTGGGTCAGG + Intergenic
1033776717 7:144619679-144619701 CTTTCATCTGTTGCTGGGTCAGG + Intronic
1034762398 7:153685263-153685285 CCTTCACCCGTAGCTGGGTCTGG + Intergenic
1035557320 8:577020-577042 CTATCATCCATCACTGTATCTGG - Intergenic
1036102073 8:5798532-5798554 CTTTCATCCATCACTTGGCCAGG - Intergenic
1036102611 8:5803186-5803208 CTTTCATCCATTGCTCTGCCAGG - Intergenic
1036107569 8:5857114-5857136 CTTTTATCCATTGCTCAGTCAGG - Intergenic
1036256220 8:7208893-7208915 CTTTCTTCCAAAGCTGGGCCTGG + Intergenic
1036308270 8:7667477-7667499 CTTTCTTCCAAAGCTGGGCCTGG + Intergenic
1036361263 8:8078601-8078623 CTTTCTTCCAAAGCTGGGCCTGG - Intergenic
1036548367 8:9794086-9794108 CTCTCATCCATTGCTGGGTTAGG + Intergenic
1036889707 8:12588403-12588425 CTTTCTTCCAAAGCTGGGCCTGG + Intergenic
1037257053 8:16966688-16966710 CTTACATCCATTGCTGGATGTGG - Intergenic
1040422218 8:47251412-47251434 CTTTACTCCATAGCTGTGTCAGG - Intergenic
1040842152 8:51795714-51795736 TATTCATCCATCATTGGGTCAGG - Intronic
1041125122 8:54629259-54629281 AGTTCATCCATCGTTGGGCCTGG - Exonic
1041128305 8:54667780-54667802 CTTTAAACCATCACTGGGTTGGG - Intergenic
1041437785 8:57861413-57861435 CTTTCATCCATGGTTAGGACAGG - Intergenic
1042432824 8:68727769-68727791 CTTTCAGCCATGGCTGGAGCAGG + Intronic
1043214602 8:77569904-77569926 CTTTCAGCCATGGCTGGAGCTGG + Intergenic
1044065952 8:87700378-87700400 TATTCATCCATCACTGGGTCAGG + Intergenic
1044179955 8:89179206-89179228 CTTTCATCAGTCGCTGGATCAGG + Intergenic
1044248317 8:89976710-89976732 TGTTCATCTGTCGCTGGGTCAGG + Intronic
1045006130 8:97918375-97918397 CTTTCATCGATGCCTGGCTCAGG - Intronic
1045765286 8:105660453-105660475 CTTTAATCCATTGGTGGGGCAGG - Intronic
1048839342 8:138551333-138551355 CTTTCAGCCATGGCTGGAGCTGG - Intergenic
1050399002 9:5230997-5231019 TATTCATCCGTCGTTGGGTCAGG + Intergenic
1050511588 9:6401987-6402009 GTTTCATACATTGCTGGTTCAGG - Intergenic
1050925039 9:11254408-11254430 TTTTCATCCATCGCTCAGTCAGG - Intergenic
1050925700 9:11260144-11260166 TTTTCAGCCATCACTTGGTCAGG - Intergenic
1050996888 9:12231932-12231954 CTTTCAGCCATGGCTGGAGCTGG + Intergenic
1052618737 9:30877615-30877637 CTCTCATCTGTTGCTGGGTCAGG + Intergenic
1052877759 9:33580217-33580239 CTTTCAGCCATGGCTGGAGCCGG - Intergenic
1052878645 9:33586404-33586426 CTTTCAGCCATGGCTGGAGCTGG - Intergenic
1052879510 9:33592605-33592627 CTTTCAGCCATGGCTGGAGCTGG - Intergenic
1053496468 9:38551627-38551649 CTTTCAGCCATGGCTGGAGCTGG + Intronic
1053497332 9:38557805-38557827 CTTTCAGCCATGGCTGGAGCTGG + Intronic
1053498226 9:38563988-38564010 CTTTCAGCCATGGCTGGAGCCGG + Intronic
1053602681 9:39626614-39626636 CATTCATCCATCGCTGGGTCAGG + Intergenic
1053666179 9:40319497-40319519 CTTTCAGCCATGGCTGGAGCTGG - Intronic
1053860328 9:42380362-42380384 CATTCATCCATCGCTGGGTCAGG + Intergenic
1053915764 9:42944544-42944566 CTTTCAGCCATGGCTGGAGCTGG - Intergenic
1054250857 9:62715821-62715843 CATTCATCCATCGCTGGGTCAGG - Intergenic
1054377332 9:64459525-64459547 CTTTCAGCCATGGCTGGAGCTGG - Intergenic
1054518430 9:66056786-66056808 CTTTCAGCCATGGCTGGAGCTGG + Intergenic
1054564962 9:66750334-66750356 CATTCATCCATCGCTGGGTCAGG - Intergenic
1055264099 9:74475795-74475817 CTTTCAGCCATGGCTGGAGCAGG - Intergenic
1057155439 9:92834157-92834179 TATTCATCCGTCGTTGGGTCAGG + Intergenic
1057161398 9:92890865-92890887 CTTTCAGCCATGGCTGGAGCTGG + Intergenic
1057676387 9:97139167-97139189 CTTTCAGCCATGGCTGGAGCTGG + Intergenic
1057676809 9:97142287-97142309 CTTTCAGCCATGGCTGGAGCAGG + Intergenic
1057677691 9:97148472-97148494 CTTTCAGCCATGGCTGGAGCTGG + Intergenic
1058046599 9:100364043-100364065 CTTTTATCTTTCACTGGGTCAGG - Intergenic
1059512971 9:114866222-114866244 CTGCCATCCATCTCTGGGTCAGG + Intergenic
1062001118 9:134216269-134216291 CCTTCATCCCTCGCTGGGCCTGG + Intergenic
1203545883 Un_KI270743v1:127802-127824 CTTTCATCCATGGCTGGAGCTGG + Intergenic
1203546791 Un_KI270743v1:134182-134204 CTTTCAGCCATGGCTGGTGCTGG + Intergenic
1185699309 X:2218472-2218494 CATTCACCCATCACTTGGTCAGG + Intergenic
1188085005 X:25893564-25893586 CTTTCATCCATTGCTCAGCCAGG + Intergenic
1188924184 X:36019118-36019140 CATTCATCTGTCGCTGGGTCAGG - Intergenic
1190912869 X:54788544-54788566 CAGTCGTCCATCTCTGGGTCAGG - Exonic
1191210418 X:57878744-57878766 CATTCATCTGTCGCTGGGTCAGG + Intergenic
1191697204 X:64002480-64002502 TATTCATCCATCACTGGGTCAGG - Intergenic
1191773444 X:64786404-64786426 CTTTCATCCATCACTCAGCCAGG - Intergenic
1192717386 X:73658894-73658916 TTTTCATCCATTGCTTGGCCAGG - Intronic
1193160099 X:78217943-78217965 CTTTCATCCGTCACTTGGCCAGG - Intergenic
1193351770 X:80472244-80472266 CTTTCATCGGTTGCTGGGTCAGG + Intergenic
1194487149 X:94498404-94498426 TATTCATCCATCGTTGGGTTAGG + Intergenic
1196387372 X:115173202-115173224 CTTTCATCCGTCATTGGGTCAGG - Intronic
1199043992 X:143147455-143147477 CTTTTAGCCATGGCTGGGCCAGG - Intergenic
1199172970 X:144753413-144753435 TATTCATCCATCATTGGGTCAGG - Intergenic
1199345557 X:146734646-146734668 TTTTCATCCATCACTTGGCCAGG - Intergenic
1199390060 X:147268987-147269009 CTTTCATCCGTCGCTTGGCCAGG + Intergenic
1199390471 X:147271982-147272004 CTTTCATCCGTTGCTTGGCCAGG + Intergenic
1199623542 X:149720343-149720365 TTTTCATCTGTCGCTTGGTCAGG + Intergenic
1200745512 Y:6900562-6900584 TATTCTTCCATCGCTGGGTCAGG + Intergenic
1200968061 Y:9119439-9119461 CATTCATTCATTGCTAGGTCAGG - Intergenic
1200976389 Y:9216052-9216074 TATTCATCCATCACTGAGTCAGG - Intergenic
1202025587 Y:20519461-20519483 CTTTCCTCCATCACTGTCTCAGG + Intergenic
1202142682 Y:21744634-21744656 CATTCATTCATCGCTAGGTCAGG + Intergenic
1202143850 Y:21757766-21757788 TATTCATCCATTGATGGGTCAGG - Intergenic
1202144176 Y:21760984-21761006 CATTCATTCATCGCTAGGTCAGG - Intergenic