ID: 994047959

View in Genome Browser
Species Human (GRCh38)
Location 5:95330509-95330531
Sequence AAGAATAAAGAGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994047954_994047959 23 Left 994047954 5:95330463-95330485 CCGATTTGTTTTGAAGGAAGAAA No data
Right 994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG No data
994047953_994047959 24 Left 994047953 5:95330462-95330484 CCCGATTTGTTTTGAAGGAAGAA No data
Right 994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994047959 Original CRISPR AAGAATAAAGAGAGGGAGGA AGG Intergenic
No off target data available for this crispr