ID: 994050232

View in Genome Browser
Species Human (GRCh38)
Location 5:95354057-95354079
Sequence CTTCCATTTGAACAACTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994050232_994050234 12 Left 994050232 5:95354057-95354079 CCACTAAGTTGTTCAAATGGAAG No data
Right 994050234 5:95354092-95354114 GTGGCCATCAGACCATACTGAGG No data
994050232_994050233 -7 Left 994050232 5:95354057-95354079 CCACTAAGTTGTTCAAATGGAAG No data
Right 994050233 5:95354073-95354095 ATGGAAGCACGAGCTGCTAGTGG No data
994050232_994050235 13 Left 994050232 5:95354057-95354079 CCACTAAGTTGTTCAAATGGAAG No data
Right 994050235 5:95354093-95354115 TGGCCATCAGACCATACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994050232 Original CRISPR CTTCCATTTGAACAACTTAG TGG (reversed) Intergenic
No off target data available for this crispr