ID: 994051116

View in Genome Browser
Species Human (GRCh38)
Location 5:95363866-95363888
Sequence TCACATAAACTTAAGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994051116_994051119 -7 Left 994051116 5:95363866-95363888 CCCTCTACCTTAAGTTTATGTGA No data
Right 994051119 5:95363882-95363904 TATGTGAGTCCTTATGTGTTAGG 0: 349
1: 430
2: 380
3: 255
4: 362
994051116_994051123 26 Left 994051116 5:95363866-95363888 CCCTCTACCTTAAGTTTATGTGA No data
Right 994051123 5:95363915-95363937 GAAGGCAGCACATGGTTCATTGG No data
994051116_994051122 18 Left 994051116 5:95363866-95363888 CCCTCTACCTTAAGTTTATGTGA No data
Right 994051122 5:95363907-95363929 AGTCTCTTGAAGGCAGCACATGG No data
994051116_994051121 8 Left 994051116 5:95363866-95363888 CCCTCTACCTTAAGTTTATGTGA No data
Right 994051121 5:95363897-95363919 GTGTTAGGTGAGTCTCTTGAAGG 0: 88
1: 291
2: 250
3: 151
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994051116 Original CRISPR TCACATAAACTTAAGGTAGA GGG (reversed) Intergenic
No off target data available for this crispr