ID: 994056122

View in Genome Browser
Species Human (GRCh38)
Location 5:95417989-95418011
Sequence GTGAAACCACAGATGAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994056122_994056125 15 Left 994056122 5:95417989-95418011 CCCACCTTCATCTGTGGTTTCAC 0: 1
1: 0
2: 2
3: 11
4: 238
Right 994056125 5:95418027-95418049 AAGTTTACAGAAATATTAAATGG 0: 1
1: 2
2: 11
3: 108
4: 1032

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994056122 Original CRISPR GTGAAACCACAGATGAAGGT GGG (reversed) Intronic
901525177 1:9816979-9817001 GAGAAAGTACAGATCAAGGTAGG + Intronic
901567720 1:10132465-10132487 AAGAAAGCACAGATGCAGGTAGG + Exonic
903849115 1:26295693-26295715 GTGACACCACAGAGGCAAGTTGG - Intronic
906790045 1:48651223-48651245 GTGAAACCACTTCTGAGGGTTGG + Intronic
910278254 1:85470815-85470837 ACGAAACCCCAGATGAAAGTTGG - Intronic
910410109 1:86934201-86934223 GTGAAACCTCGGATGAGGGGAGG + Intronic
910549449 1:88459613-88459635 ATGAAGACACTGATGAAGGTGGG - Intergenic
912007078 1:104917379-104917401 GTGGAACCAGAGAGAAAGGTCGG + Intergenic
912572123 1:110632375-110632397 TGGAAGCCACAGATGAAGGCTGG + Intergenic
912664919 1:111570312-111570334 GTCAAACCAAGGTTGAAGGTTGG + Intronic
916683808 1:167126911-167126933 CTGAAACACCAGAAGAAGGTGGG + Exonic
917433348 1:174994423-174994445 GACAAACCAGAGATGGAGGTAGG - Intronic
921026736 1:211291059-211291081 GTGAAACTACGGATTAAGGGAGG - Intronic
921287116 1:213618925-213618947 GTGAAATCACAGAATAATGTGGG + Intergenic
922980045 1:229818084-229818106 GGCAAACCCCAGAGGAAGGTGGG - Intergenic
923355962 1:233156109-233156131 GTGAAACAGCATATCAAGGTTGG + Intronic
924214747 1:241809463-241809485 GAGAAACCACACAGGAATGTGGG + Intergenic
1063055409 10:2499068-2499090 GTGAAAACACCGATAAAGGAAGG + Intergenic
1063724978 10:8627008-8627030 GTGAAAACAGAGATGAAATTGGG - Intergenic
1064749139 10:18508369-18508391 CTGAATCCACAGAGGAAGGGAGG + Intronic
1068642563 10:59426448-59426470 GGGAGGCCAGAGATGAAGGTCGG - Intergenic
1069266962 10:66471673-66471695 GTGACATCACATATAAAGGTCGG + Intronic
1071241481 10:83710707-83710729 GTGATGTCACAGATGCAGGTGGG + Intergenic
1071354216 10:84777640-84777662 GTGAAGCCAGAGAGAAAGGTAGG - Intergenic
1071683527 10:87731528-87731550 GTGATTCCTCAGATGAATGTGGG + Intronic
1073020440 10:100439060-100439082 GTGAGAGCACAGAGGAAGGGAGG - Intergenic
1073168218 10:101477295-101477317 GTTAAAACACAGATCACGGTGGG - Intronic
1074163176 10:110851145-110851167 CTCAAACCACAGAAGAAGGGCGG - Intergenic
1077396571 11:2326660-2326682 GTGCAGCAACAGATGCAGGTGGG - Intergenic
1077502694 11:2916533-2916555 GTGCAACCAAAGGTGCAGGTTGG + Intronic
1079419399 11:20272072-20272094 TTGAAATCACATATGTAGGTAGG + Intergenic
1081503661 11:43692457-43692479 CTGATACCACAGATGAAGAAAGG - Intronic
1081742337 11:45449378-45449400 GTGTAAGCACAGGTGAGGGTGGG + Intergenic
1082224672 11:49690834-49690856 GTCAATCCATAGATGAAGCTTGG + Intergenic
1083503297 11:63131682-63131704 GGGCAGCCAGAGATGAAGGTGGG - Intronic
1084987250 11:72886293-72886315 TTGAACCAAAAGATGAAGGTAGG - Intronic
1086409968 11:86535251-86535273 CTGGAAGAACAGATGAAGGTAGG - Intronic
1087217113 11:95506050-95506072 GTGAAACCACAGATAAGGCGAGG - Intergenic
1088205263 11:107385600-107385622 GTAAAACCACAGGTAAAGGGGGG - Intronic
1088335023 11:108694232-108694254 GCGAAACCACAGATAGAGGGGGG + Intronic
1089398075 11:118148758-118148780 GTGAAAATACAGATCAATGTGGG - Intronic
1090268704 11:125370924-125370946 CTAGAACCACAGATGAAGGAAGG + Intronic
1090434231 11:126673558-126673580 GTGAAAACACAGATGAATTTTGG - Intronic
1090831508 11:130423907-130423929 CTGAAACCAGATAAGAAGGTGGG + Intronic
1090857480 11:130623078-130623100 GTGAGCCCACAGAGGAAGGTAGG + Intergenic
1094088663 12:26623147-26623169 GTAAAACCACAGATAGAGTTGGG - Intronic
1096769481 12:53925605-53925627 CTGAAACAACAGATAAGGGTCGG + Intergenic
1098249831 12:68558101-68558123 GGGAAAGGACAGAGGAAGGTAGG - Intergenic
1099101203 12:78442785-78442807 ATGTAACCACTGATGAAGTTAGG + Intergenic
1100990134 12:100243213-100243235 GTGAAACCACAGATAAAAGGGGG + Intronic
1101521903 12:105491602-105491624 GTGAAAACACAGATGAACCTGGG - Intergenic
1102689697 12:114750633-114750655 TTGAAATCACAGTTGAGGGTTGG + Intergenic
1103174779 12:118853382-118853404 GTCAAACCAAAGAAAAAGGTGGG + Intergenic
1103340920 12:120220783-120220805 ATGAAACCTCAGCTGAAGGGAGG + Intronic
1105621703 13:22073819-22073841 GTGAAACCTCAGATAAAGGTGGG + Intergenic
1110911266 13:80967697-80967719 GTGAAACCACTGCAGAAGATAGG + Intergenic
1112006479 13:95258163-95258185 GGGAAACCAAGGGTGAAGGTGGG - Intronic
1112904687 13:104402383-104402405 GTGACAACACAGATGAACCTGGG + Intergenic
1113227998 13:108180034-108180056 GTGAATCCAAAGATTCAGGTGGG - Intergenic
1113351610 13:109535036-109535058 CTGAAGCCAGAGGTGAAGGTGGG - Intergenic
1113639770 13:111949091-111949113 GTGAGATCACAGAGGAAGGGTGG + Intergenic
1114453845 14:22843173-22843195 GTGAAACCAAAGCTGCTGGTGGG + Intronic
1117543663 14:56772609-56772631 ATGAATCCAGAGATGAAAGTAGG + Intergenic
1118307537 14:64667727-64667749 GTGATCCCAGTGATGAAGGTGGG - Intergenic
1118794273 14:69126488-69126510 TTGAATCCATAGATGAAGTTGGG - Intronic
1120244361 14:81989097-81989119 CTGAAAGCTCAGATGATGGTCGG + Intergenic
1121663333 14:95652427-95652449 GAGACACTCCAGATGAAGGTTGG + Intergenic
1124873170 15:33564063-33564085 GAGAAAACAAAGATCAAGGTGGG - Intronic
1124967520 15:34447303-34447325 GTCAAAGCCCAGTTGAAGGTTGG + Intergenic
1125122833 15:36183111-36183133 CTGTAACCAGAGAGGAAGGTAGG + Intergenic
1126242547 15:46461743-46461765 CTGAAACCACAGATACAGGGAGG + Intergenic
1126317726 15:47388300-47388322 GTGAAACAACAGGTAAAGGAGGG - Intronic
1126417279 15:48430895-48430917 GTGAAATAACAGATGAAAATTGG - Intronic
1126736359 15:51735778-51735800 GTGAAACCACAGACGGCTGTGGG + Intronic
1127208879 15:56750255-56750277 GTGAAACCAGAGAAGAACCTAGG + Intronic
1128109159 15:65065599-65065621 GTGAAACCTCAACTGAAGGGAGG + Intronic
1130640954 15:85674706-85674728 GTGTGACCAAAGATCAAGGTGGG + Intronic
1132114587 15:99126196-99126218 TTGAAACCACAGATGCAGTCTGG + Intronic
1132856293 16:2046395-2046417 GTGGGGCCACAGGTGAAGGTAGG + Intronic
1135942905 16:26838342-26838364 GAGTGACCTCAGATGAAGGTAGG - Intergenic
1137794327 16:51202636-51202658 AGGAAACCACAGATGAACCTAGG - Intergenic
1138208574 16:55143692-55143714 GTGTTATCACAGAAGAAGGTAGG + Intergenic
1140133606 16:72185471-72185493 GTGAACCCAAAGATGATGGGAGG - Intergenic
1142310872 16:89312787-89312809 GTGAAACCACAGCCTGAGGTGGG + Intronic
1142489200 17:266964-266986 GTGAGGCCAGAGATGAAGCTTGG - Intronic
1143611397 17:8019897-8019919 GTGTAAACACATCTGAAGGTGGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147889899 17:43709899-43709921 GTCTAACCCCAGATGGAGGTGGG - Intergenic
1148976291 17:51532763-51532785 GTGAAACCACAGCTGAAATGTGG - Intergenic
1149514692 17:57271601-57271623 GTAAAAACCCAGATGAAGGAAGG - Intronic
1149620293 17:58039779-58039801 GTGCAGCCACAGAAGAAGGAGGG + Intergenic
1150132236 17:62675421-62675443 GGGAAACCACAGCTAAAGGCTGG - Intronic
1150946059 17:69746823-69746845 TTGAAACACCATATGAAGGTTGG - Intergenic
1151539598 17:74758298-74758320 GGGAAAGGACAGATGAAGGGAGG + Intronic
1152110361 17:78354370-78354392 GTGGAAAGACAGAGGAAGGTTGG + Intergenic
1155101789 18:22617934-22617956 GTGAAGCCAGAGAGAAAGGTCGG + Intergenic
1157958308 18:52124016-52124038 TTGAAGACACAGATGAAAGTAGG + Intergenic
1158502620 18:58017195-58017217 TTGAGGCCTCAGATGAAGGTGGG + Intergenic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1162659920 19:12160873-12160895 ATAAAACCACTAATGAAGGTCGG - Intergenic
1162919041 19:13889659-13889681 GGGAAACCACAGGAGAAAGTGGG - Exonic
1163413633 19:17172460-17172482 GTGAAATATCAGATCAAGGTAGG + Exonic
1165296456 19:34930248-34930270 ATCAAACCACAGATGGATGTAGG - Intronic
1167686900 19:50962195-50962217 CTGAAACTACTGAAGAAGGTGGG - Intronic
925601992 2:5617517-5617539 GGGGAAGCACAGATGATGGTGGG + Intergenic
926317512 2:11721939-11721961 GAGCAACCACAGATGAATGATGG - Intronic
927058967 2:19395942-19395964 GTGCAATAACAGATGAAGATGGG + Intergenic
927861938 2:26565516-26565538 GTGAAACACCACATGACGGTTGG - Intronic
928926876 2:36588825-36588847 GTGAAACCAGAGAATATGGTGGG + Intronic
929038033 2:37713635-37713657 GTGAAACCAAGGATAAAGGGAGG + Intronic
929652092 2:43690443-43690465 GTGAACCCACAGATGAAACCTGG + Intronic
930321180 2:49856680-49856702 CTGTAAGCCCAGATGAAGGTAGG + Intergenic
930843193 2:55871089-55871111 GTGAGACCACAAATGAATGCCGG - Exonic
931475656 2:62585254-62585276 GGGCAACCACAGAGAAAGGTTGG - Intergenic
931776015 2:65541053-65541075 GTGGAACCCAAGTTGAAGGTGGG + Intergenic
932423428 2:71614357-71614379 GTGAAACTACAGATGCAGCAAGG - Intronic
935493421 2:103748123-103748145 GTGAAATCACATATGAAGAATGG - Intergenic
935636441 2:105252665-105252687 AGGAAACCAGAGAAGAAGGTAGG - Intergenic
937744314 2:125393173-125393195 ATGCAAACACATATGAAGGTTGG + Intergenic
938041215 2:128077811-128077833 CTGAAACAAGAGATGAAGATTGG - Intergenic
938230788 2:129656991-129657013 CTTAAGCCACAGAAGAAGGTGGG + Intergenic
938250365 2:129811120-129811142 GAAAAACCAGAGATGAAGTTAGG - Intergenic
939280802 2:140062275-140062297 GTGAAACCATAGGAGAAGGATGG - Intergenic
939906866 2:147927096-147927118 GTGAAACCATTGAAGAATGTTGG + Exonic
942146577 2:173032843-173032865 GTGAATCAACTGTTGAAGGTAGG + Intronic
942942747 2:181638736-181638758 GTGACAGCACAGCTGAAGTTTGG + Intronic
945179617 2:207078411-207078433 ATGAGACCACAGATGAAAATAGG + Exonic
947923435 2:233899882-233899904 GTGACACCAAAGAAGAAGATTGG + Intergenic
1170144285 20:13155528-13155550 GTTAAAACACACATGAAGGCTGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1179305860 21:40153554-40153576 GTACAAGCACAGATGAAGCTAGG + Intronic
1181746194 22:24956488-24956510 GAGAAGCAACAGAGGAAGGTGGG + Intronic
1182168638 22:28203708-28203730 GTTAATCCACAGAGGCAGGTGGG - Intronic
1182945745 22:34319817-34319839 GTGGAAGCAGAGATGGAGGTGGG + Intergenic
1183620050 22:38966969-38966991 TGGAAACCTCAGAAGAAGGTGGG - Intronic
949633461 3:5955532-5955554 GTGAAACATCAGATGATTGTAGG + Intergenic
950040193 3:9915220-9915242 GGGAAGCAACAGATGAAGGCTGG - Intronic
950086965 3:10265892-10265914 GTGAAGCCGCAGATGAAAATAGG - Intronic
950339229 3:12227842-12227864 CTGATACCACAGATGAAGCCCGG + Intergenic
951862736 3:27272215-27272237 GTGAAACCCCAGACAAAGGCTGG - Intronic
956539221 3:70315722-70315744 GTGAACCCACAGTTGATGGCTGG + Intergenic
956794988 3:72709860-72709882 GTGACACCACACATCAAGGTAGG + Intergenic
960267515 3:115637494-115637516 GTGCAACCAAAGGTGTAGGTGGG - Intronic
962866036 3:139448626-139448648 TTGACAGGACAGATGAAGGTGGG - Intergenic
963356117 3:144210482-144210504 GTGCACACCCAGATGAAGGTTGG + Intergenic
964052825 3:152417669-152417691 GTGAAAGAACAAATGAAGGAAGG + Intronic
965161452 3:165138774-165138796 GGGCAGCCACAGATAAAGGTCGG - Intergenic
966458314 3:180143518-180143540 GTGAAACTTAAGATGAAGGCAGG - Intergenic
966827998 3:183981334-183981356 GTGAAACCACAGAGTAGAGTGGG + Intronic
971084492 4:23256041-23256063 GTGAAACCATGAATAAAGGTAGG + Intergenic
972873300 4:43327331-43327353 GAGAAACAGCAGATGAAGGAAGG - Intergenic
975268780 4:72404182-72404204 GTGAAACCACAGAGGACCCTTGG + Intronic
978367906 4:108001881-108001903 GTAAAACCACAGATAAAGGGGGG + Intronic
978852573 4:113356038-113356060 GTTGAACCAAAGATGAAGGCTGG + Exonic
979457121 4:120939720-120939742 GTGAACCCACAGATGAGGAGGGG - Intergenic
979619180 4:122779273-122779295 GTGATTCCTCAGATGGAGGTGGG - Intergenic
980593853 4:134927407-134927429 GGGAAACCAGAGAGAAAGGTCGG - Intergenic
981429275 4:144641587-144641609 GTGATTCCACAGAGGAAGGACGG - Intergenic
983030655 4:162797700-162797722 GTGAAACCACGGATAAGGGTGGG - Intergenic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
986394161 5:7311948-7311970 TGGAAACCACATATGAAAGTTGG - Intergenic
987686642 5:21212890-21212912 GAGAAAGAAGAGATGAAGGTAGG + Intergenic
988207670 5:28160997-28161019 GTGAAGCCATAGATCAAGTTGGG - Intergenic
988402855 5:30784240-30784262 GTGAAACCACAGATAAGAGGAGG - Intergenic
988647701 5:33112282-33112304 GTGAATCTACAGATCAAGTTGGG + Intergenic
989456294 5:41648163-41648185 GTGGAACCTCAGAGGAAGGCTGG + Intergenic
989704136 5:44307669-44307691 ATGAAACAAAAAATGAAGGTAGG + Intronic
989785871 5:45328767-45328789 GGGAAACCACAGATAAAGGCAGG + Intronic
991632273 5:68668027-68668049 ATGGAACCACAGATGGAGTTAGG - Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
994056122 5:95417989-95418011 GTGAAACCACAGATGAAGGTGGG - Intronic
994672489 5:102779479-102779501 ATGAAACCACAGATAAGGGGGGG - Intronic
995078793 5:108020920-108020942 GTAAAATCACAGATTATGGTAGG - Exonic
995301818 5:110594055-110594077 GTGAAACCAACGCAGAAGGTGGG + Intronic
995309458 5:110694041-110694063 GCGCAACCACAGAGAAAGGTCGG + Intronic
995736154 5:115301825-115301847 GTGAAACCACAGAAGAAAACAGG - Intergenic
996921326 5:128770870-128770892 GTGACATCAGGGATGAAGGTAGG + Intronic
998322250 5:141243298-141243320 TTGAAATCACAGAGGGAGGTGGG - Intergenic
998468214 5:142362962-142362984 GTGAAATCACAAAGGAAGGCAGG + Intergenic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
999556714 5:152751717-152751739 GTGAGATCAAAGAAGAAGGTGGG + Intergenic
999675539 5:153998017-153998039 GTGAAACCACAGATAAGGGGGGG - Intronic
1000447700 5:161344537-161344559 GGGAAACAACAGATGCTGGTGGG + Intronic
1001832970 5:174805080-174805102 GTGAAGACACAGATGCAGGAGGG - Intergenic
1004935168 6:20500306-20500328 GTGAAAACATAGATGAACCTTGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005200219 6:23336238-23336260 GGGAAGTCACAGATGAATGTGGG + Intergenic
1005975924 6:30799125-30799147 GAGAAACCAAAGAACAAGGTAGG + Intergenic
1006565812 6:34956107-34956129 GTGGAACCAAAGATAGAGGTTGG - Intronic
1007194038 6:40044485-40044507 AAGAAACCACAGATGCTGGTTGG + Intergenic
1008386764 6:50900652-50900674 GAGAAACAATAGAAGAAGGTGGG + Intergenic
1008452195 6:51665923-51665945 GTGTAAGCACAGGTGGAGGTGGG + Intronic
1008873070 6:56295509-56295531 TTGAATCCATAGATGAAGTTAGG + Intronic
1010722550 6:79300274-79300296 GAGAAACAACAGATGCAGGAAGG - Intergenic
1011304052 6:85907428-85907450 GGGCAACCAGAGAGGAAGGTCGG - Intergenic
1011541826 6:88438892-88438914 GTGAAACCACAGATTAGTGAGGG - Intergenic
1013861019 6:114635517-114635539 GAAAAACCACAGATAAGGGTGGG - Intergenic
1014342066 6:120222919-120222941 GTGAAACCAGAGATTGAGGTAGG - Intergenic
1016983955 6:149880283-149880305 GTGAAACTGCAGGTGAAGGATGG + Intergenic
1019860382 7:3653252-3653274 GGGAAAGCACAGAGGAAGGAGGG - Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1021021931 7:15610928-15610950 ATGAAGCCACAGATAAAAGTAGG - Intergenic
1023597032 7:41840899-41840921 CTGAATCCACAGATCAAGTTGGG + Intergenic
1023756305 7:43420866-43420888 CTGAAACCACAGATCAATTTGGG - Intronic
1027562519 7:79750021-79750043 GTGAAACCACAGATAAGGAAAGG + Intergenic
1030413324 7:109210149-109210171 GAGAAACAACAGATGCTGGTGGG - Intergenic
1032433211 7:131879854-131879876 GTGATCCCCCAGATGAAGGATGG + Intergenic
1033321989 7:140348143-140348165 GTGAAACCACAGATAAGTGGGGG + Intronic
1036134558 8:6148218-6148240 AAGAAACCACACATGAAGGAAGG + Intergenic
1036508414 8:9377894-9377916 GTAAAACCACAGATGGTGGGGGG - Intergenic
1038418971 8:27420003-27420025 CTGCACCCACAGATGACGGTGGG + Exonic
1040331766 8:46389222-46389244 GTGAAACCACAGGTAATGCTGGG + Intergenic
1040398285 8:47020331-47020353 GTGCAGCCACAGAGAAAGGTTGG + Intergenic
1042231888 8:66565589-66565611 GTGTAACTGCAAATGAAGGTTGG - Intronic
1042435046 8:68754470-68754492 GTTAAACAGCAGGTGAAGGTTGG + Intronic
1043809954 8:84727020-84727042 ATGAAACAGCAGATGAAGCTTGG + Intronic
1044133786 8:88559313-88559335 GTGAAATCATAGATGCAGGCTGG - Intergenic
1044830781 8:96245855-96245877 GTGAAAGAAAATATGAAGGTAGG - Exonic
1045169684 8:99650761-99650783 CTGAAACCACAGATAAGGGCAGG + Intronic
1046988953 8:120427665-120427687 AAGAAACCAGAGATGAAGGCTGG + Intronic
1047565092 8:126035207-126035229 GTGAAGACACTGATGAAGCTGGG - Intergenic
1050071821 9:1823056-1823078 GGGAAACCAGAGAGAAAGGTCGG - Intergenic
1050784257 9:9379603-9379625 TTGAATCTACAGATGAAGTTGGG + Intronic
1051746545 9:20300075-20300097 GTAAATACACAGATGATGGTTGG + Intergenic
1051798603 9:20905216-20905238 CTTCAACCACAGCTGAAGGTGGG - Intronic
1051900649 9:22035557-22035579 GTGGAACCACAGACCAAGCTAGG - Intergenic
1053143870 9:35698964-35698986 GTAAAGTCAGAGATGAAGGTGGG + Intronic
1055084272 9:72298518-72298540 GTGAAATCACAGATAATGGGTGG + Intergenic
1056000512 9:82211372-82211394 TTGAATCTACAGATGAATGTAGG - Intergenic
1056273793 9:84973009-84973031 TTGAAAGCTCAGATGAAGTTTGG - Intronic
1060893031 9:127200577-127200599 GTGAAACCCAAGATGGGGGTTGG + Intronic
1062631970 9:137467126-137467148 GAGAAGGCACAGATGCAGGTTGG - Intronic
1185981136 X:4780143-4780165 GTGAATACACAGTTGAAGCTTGG + Intergenic
1187614134 X:20974671-20974693 GTGAAACCATGGATAAGGGTGGG + Intergenic
1188650042 X:32621324-32621346 GTGGACCCACAGATTAAGGTAGG - Intronic
1190777296 X:53563172-53563194 GTGAAACCACAGAGGATACTGGG + Intronic
1191105578 X:56770178-56770200 GTGGAAGCACAGATGAAGACAGG - Intergenic
1191106571 X:56775580-56775602 GTGGAAGCACAGATGAAGACAGG - Intergenic
1191107587 X:56781158-56781180 ATGCAACCACAGATGAAGACAGG - Intergenic
1191108198 X:56785392-56785414 ATGGAAGCACAGATGAAGATGGG - Intergenic
1192389875 X:70715197-70715219 GTGAAGCCAGAGAGAAAGGTCGG - Intronic
1193645609 X:84065867-84065889 GTGAGACCAAAGCAGAAGGTGGG + Intronic
1194267454 X:91772376-91772398 GTGAAACCACAAAGGCAGTTTGG - Intergenic
1195888499 X:109667438-109667460 GGGAAACCAAAGAAGAAGTTAGG + Intronic
1197952691 X:131914979-131915001 TCAAAACCACAGATCAAGGTTGG + Intergenic
1198041368 X:132856146-132856168 GTGAAACCACAGATAAGGGTGGG - Intronic
1200584660 Y:4993314-4993336 GTGAAACCACAAAGGCAGTTTGG - Intergenic
1200936096 Y:8739813-8739835 GTGAAACCCAGGATGAAGGGAGG - Intergenic
1201013294 Y:9572211-9572233 GTGCAACCAGAGAGAAAGGTCGG - Intergenic
1201920757 Y:19231221-19231243 GGGAAACCAGAGAGAAAGGTCGG - Intergenic