ID: 994057456

View in Genome Browser
Species Human (GRCh38)
Location 5:95434348-95434370
Sequence CATGGAAAACACAAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5275
Summary {0: 1, 1: 0, 2: 6, 3: 156, 4: 5112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994057456_994057460 1 Left 994057456 5:95434348-95434370 CCTTCCTTCTTGTGTTTTCCATG 0: 1
1: 0
2: 6
3: 156
4: 5112
Right 994057460 5:95434372-95434394 GGCCTTTCTCCAGCAACAGCAGG 0: 1
1: 0
2: 2
3: 17
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994057456 Original CRISPR CATGGAAAACACAAGAAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr