ID: 994057460

View in Genome Browser
Species Human (GRCh38)
Location 5:95434372-95434394
Sequence GGCCTTTCTCCAGCAACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 247}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994057453_994057460 15 Left 994057453 5:95434334-95434356 CCAGAGGCCGCCTACCTTCCTTC 0: 1
1: 0
2: 2
3: 29
4: 236
Right 994057460 5:95434372-95434394 GGCCTTTCTCCAGCAACAGCAGG 0: 1
1: 0
2: 2
3: 17
4: 247
994057452_994057460 22 Left 994057452 5:95434327-95434349 CCTTGCTCCAGAGGCCGCCTACC 0: 1
1: 0
2: 1
3: 10
4: 173
Right 994057460 5:95434372-95434394 GGCCTTTCTCCAGCAACAGCAGG 0: 1
1: 0
2: 2
3: 17
4: 247
994057454_994057460 8 Left 994057454 5:95434341-95434363 CCGCCTACCTTCCTTCTTGTGTT 0: 1
1: 0
2: 4
3: 101
4: 1043
Right 994057460 5:95434372-95434394 GGCCTTTCTCCAGCAACAGCAGG 0: 1
1: 0
2: 2
3: 17
4: 247
994057455_994057460 5 Left 994057455 5:95434344-95434366 CCTACCTTCCTTCTTGTGTTTTC 0: 1
1: 0
2: 5
3: 140
4: 1473
Right 994057460 5:95434372-95434394 GGCCTTTCTCCAGCAACAGCAGG 0: 1
1: 0
2: 2
3: 17
4: 247
994057456_994057460 1 Left 994057456 5:95434348-95434370 CCTTCCTTCTTGTGTTTTCCATG 0: 1
1: 0
2: 6
3: 156
4: 5112
Right 994057460 5:95434372-95434394 GGCCTTTCTCCAGCAACAGCAGG 0: 1
1: 0
2: 2
3: 17
4: 247
994057458_994057460 -3 Left 994057458 5:95434352-95434374 CCTTCTTGTGTTTTCCATGTGGC 0: 1
1: 2
2: 2
3: 27
4: 391
Right 994057460 5:95434372-95434394 GGCCTTTCTCCAGCAACAGCAGG 0: 1
1: 0
2: 2
3: 17
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994057460 Original CRISPR GGCCTTTCTCCAGCAACAGC AGG Intronic
900495253 1:2973231-2973253 GTCCTTTGTCCATCTACAGCGGG + Intergenic
901734557 1:11304277-11304299 TGCCTGTCTCCCCCAACAGCTGG + Intergenic
901814666 1:11787389-11787411 GGCCTGTGTCCAGCAGCTGCGGG - Exonic
902167522 1:14584360-14584382 GGCCTTTCTCCACCCAGAGAAGG - Intergenic
903564534 1:24254872-24254894 GGCCTGGCTCCAGCTATAGCTGG - Intergenic
903776914 1:25799583-25799605 GGCCTTGTTCCAGGCACAGCAGG - Intergenic
904287151 1:29460147-29460169 GGCCACTCACCAGCCACAGCTGG - Intergenic
904911805 1:33939803-33939825 GGCCTTTCTCCATCCACTGTGGG - Intronic
905389321 1:37626128-37626150 GGCCTGACTCCAGCTACAGTGGG - Intronic
905402898 1:37716289-37716311 GGCCCTTCTGCAGAAACAGCTGG + Exonic
906613609 1:47220131-47220153 GGCGTATCTTCACCAACAGCCGG - Exonic
912950739 1:114118621-114118643 GGCCCCTCTGCAGCAGCAGCAGG - Intronic
914492912 1:148163585-148163607 GGCCTTTCTGTAGCAATACCTGG - Intergenic
915539089 1:156556535-156556557 GGCAGTGCTCCAGCAGCAGCAGG - Exonic
917591328 1:176480082-176480104 GGCTTCTCTCCAGCAGCAGCTGG - Intronic
918218815 1:182416880-182416902 GGCTTTACTGCAGCAATAGCAGG + Intergenic
919641464 1:200048677-200048699 GGCCTATTTGCAGCAAGAGCAGG + Exonic
919925186 1:202188502-202188524 GACCATTGTCCAGCAACACCTGG - Intergenic
920004752 1:202824988-202825010 GTCCTTAGTCCAGCAACATCAGG - Intronic
922234499 1:223712831-223712853 GGCCCTACTCCAGCAAAACCCGG + Exonic
923672484 1:236052529-236052551 GTCCTGTCTCCAACTACAGCAGG + Intronic
1064207756 10:13338540-13338562 GGCCTGACTTCAGCAACTGCAGG + Intronic
1064767043 10:18685592-18685614 GGCCCTTCCCCATCAAAAGCAGG - Intergenic
1065484019 10:26219051-26219073 GGCCTTTCTCCATCACACGCCGG - Exonic
1068930213 10:62581795-62581817 ACTCATTCTCCAGCAACAGCTGG + Intronic
1069583273 10:69579356-69579378 GGCCTTTCACCAGCAATTGAAGG + Intergenic
1070821780 10:79360285-79360307 TGCCTTTCTCCAGCAGCTGAAGG - Intergenic
1073216309 10:101838627-101838649 GGCCTGTCTCCAGTGACAGATGG - Intronic
1073458388 10:103651391-103651413 GGCCTTTCTCCTGCCCCAGTGGG + Intronic
1073944223 10:108731365-108731387 TGCCTCTCTCCAGGAACACCTGG + Intergenic
1074097750 10:110328967-110328989 GGCCTCTCTTCAGGCACAGCTGG - Intergenic
1074153763 10:110781267-110781289 GGGCCTGCTCCAGCTACAGCAGG + Exonic
1075120466 10:119660746-119660768 AGCTTTTCTCCAGCACTAGCTGG - Intronic
1075964357 10:126598245-126598267 GGCCCTTCTCCAGCAGCTGTAGG + Intronic
1076886139 10:133263432-133263454 GACCTTCCCCCAGCAACTGCAGG - Intronic
1077081265 11:725721-725743 GGCCGTCCTCCAGCACCTGCGGG - Exonic
1077542172 11:3151879-3151901 GGCCCCTCTCCAGGAGCAGCCGG - Intronic
1077594968 11:3523993-3524015 ATCCTTTCTCGAGGAACAGCAGG + Intergenic
1079807037 11:24944845-24944867 AGCCTTTATCCTGCAACAGAAGG - Intronic
1080319303 11:30987919-30987941 AGCCTTTCTCTATCTACAGCAGG - Intronic
1080319368 11:30988592-30988614 AGCCTTTCTCTATCTACAGCAGG + Intronic
1082720260 11:56665631-56665653 TGCCCTTCACCAGCATCAGCAGG + Intergenic
1083932542 11:65853822-65853844 GCCCTCTCTCCAGTGACAGCAGG + Intronic
1084188996 11:67490506-67490528 GGCCTTTCTCCTGTCACTGCTGG + Intronic
1084303628 11:68267214-68267236 GACCGTGCTCCAGCTACAGCAGG + Intronic
1084494601 11:69496746-69496768 GTCATTCCTCCAGCCACAGCAGG + Intergenic
1084666454 11:70578987-70579009 TCCCTTTATTCAGCAACAGCTGG - Intronic
1085796051 11:79540939-79540961 GGTTTTTCTGCAGCACCAGCTGG - Intergenic
1090224775 11:125063405-125063427 GGGCCTTCTCCAGGGACAGCTGG + Exonic
1090272496 11:125397906-125397928 TGACTTTCTCCAGCTCCAGCAGG - Exonic
1091269748 11:134299709-134299731 AGCCTTTCTCCCTCACCAGCAGG - Intronic
1091397903 12:165113-165135 TGCCCTTCTCAAGCTACAGCAGG + Intronic
1092421137 12:8332765-8332787 TTCCTTTCTCGAGGAACAGCAGG + Intergenic
1095637902 12:44453793-44453815 TGCCATTCACCAGCAAAAGCAGG + Intergenic
1095640399 12:44479849-44479871 GGCCTTTATCCAGCTAACGCAGG + Intergenic
1096366992 12:51036371-51036393 GACCTTTACCCAGCATCAGCAGG - Intergenic
1098658106 12:73058354-73058376 GGGCCCTCTCCACCAACAGCTGG - Intergenic
1099689011 12:85926766-85926788 GGCCTTTCTCCAGAAACCTAGGG - Intergenic
1102101612 12:110282142-110282164 GGCTTCTCTCCAGCAGCAGCCGG + Intronic
1102698442 12:114818002-114818024 GGCCTCTCTCCTGGAGCAGCTGG + Intergenic
1103553450 12:121751822-121751844 GGCCTTTCAGCAGCAGCAGTTGG + Intronic
1103588048 12:121970914-121970936 GGCATTTCTCCAACACAAGCTGG - Intronic
1103901305 12:124304846-124304868 GGCCCTTCTCCCGCAAGAGGGGG - Intronic
1104678054 12:130729256-130729278 GGCCTTCCTCCACCTCCAGCAGG + Intergenic
1104714097 12:131005267-131005289 CACCTTCCTCCAGCATCAGCAGG + Intronic
1105813375 13:24012905-24012927 GCCCTGTCCCCAGCCACAGCTGG - Intronic
1105990953 13:25620271-25620293 GACCTCTCACCAGCAACAGAGGG + Intronic
1106702364 13:32244035-32244057 GGCCCTTCTCCAGCAGCTGTGGG - Exonic
1107709441 13:43137275-43137297 TGGCTTTTTCCAGCAGCAGCTGG + Intergenic
1108252341 13:48579638-48579660 GGCCTGACTCCAGCTACACCTGG - Intergenic
1109005717 13:56872796-56872818 GTCCTTTCTCTAGCAACATATGG + Intergenic
1110130611 13:72004459-72004481 ACCCTTTATCCAGTAACAGCTGG + Intergenic
1110336496 13:74338101-74338123 GTCCTTTCTCAAGCAAAACCAGG + Intergenic
1111183823 13:84702488-84702510 GGCATTTCTCCAGATACAGTAGG - Intergenic
1117840502 14:59855977-59855999 GTCCTTTCGCTAGAAACAGCAGG + Intronic
1118933950 14:70269030-70269052 GGCCATTCTCCAGCTGCTGCAGG - Intergenic
1119281933 14:73416825-73416847 GGCAGTTCTCCAGCAAAGGCCGG + Intronic
1119719737 14:76882892-76882914 GGCCTCCCTGCAGCCACAGCTGG - Intergenic
1122789784 14:104179349-104179371 GGCCAGGCTCCAGCATCAGCCGG - Exonic
1124728420 15:32175821-32175843 ACCCATTCTCCAGCACCAGCTGG + Intergenic
1125536786 15:40445501-40445523 GGCCTTGCTCCGGCAACATCTGG + Intronic
1127384888 15:58459508-58459530 GGACTTCCTCCAGAAACTGCTGG - Intronic
1131149696 15:90039450-90039472 GGGCTTTCTGCAGTGACAGCTGG + Intronic
1132091829 15:98953565-98953587 GGCCCTTATCCCGCAGCAGCCGG - Intronic
1132204670 15:99978123-99978145 GTCCTTTCTCCAGCAAGGCCAGG - Intronic
1133045936 16:3088310-3088332 GGAATTTCTCCTGCAACATCTGG + Intergenic
1133359869 16:5165830-5165852 TTCCTTTCTCGAGGAACAGCAGG + Intergenic
1134209748 16:12266308-12266330 GGCAATTCTCCAACACCAGCCGG + Intronic
1135086925 16:19482472-19482494 GGCTTCTCTCCAGAAACATCTGG + Intronic
1135505960 16:23036531-23036553 GACCCTTCTCCAGCAACATTTGG + Intergenic
1135525773 16:23212703-23212725 AGCCTTTGTCCAGGAAGAGCTGG + Exonic
1135658621 16:24274480-24274502 TGCATTGCTCCACCAACAGCAGG + Intronic
1137250150 16:46735541-46735563 CGCCTTTCTCCAGCAGCTGAAGG + Intronic
1138658352 16:58503387-58503409 GGCCGTTCCCCTGCAGCAGCAGG + Intronic
1139482424 16:67237818-67237840 TCCCCTTCCCCAGCAACAGCTGG - Intronic
1140318549 16:73923934-73923956 GACATTTGTCCAGCAACAGCAGG - Intergenic
1140929149 16:79610923-79610945 GGGCTCTCTCTAGCAGCAGCAGG - Intergenic
1141140783 16:81495553-81495575 GGCCTGTGGCCAGCAGCAGCAGG - Intronic
1141569018 16:84923016-84923038 GGCCCCTCTCCAACAGCAGCTGG + Intergenic
1141664318 16:85458119-85458141 GGCCCCTCTGCAGCACCAGCCGG + Intergenic
1141696367 16:85621697-85621719 GGGGTTTCTCCAGCCACGGCTGG + Intronic
1142407768 16:89900751-89900773 GGCCTCTCTCCTGATACAGCAGG + Exonic
1142483127 17:230577-230599 GGCCTTTCTCCTGAGCCAGCAGG - Intronic
1144483131 17:15643982-15644004 AGCCATTCTCCAACAACAGCTGG + Intronic
1144775680 17:17783474-17783496 GGATTTTCTCCGGCAGCAGCAGG + Intronic
1144915552 17:18721047-18721069 AGCCATTCTCCAACAACAGCTGG - Intronic
1146834335 17:36098234-36098256 TGCCTTTCACAAGCAAGAGCAGG + Intergenic
1149546528 17:57507995-57508017 GCCCTTTATCTAGCATCAGCTGG - Intronic
1150549083 17:66192253-66192275 GGCATTTCTCCACCCACAGGTGG + Intergenic
1151425302 17:74027242-74027264 GGCTCTTCTCCAGGAACAGGGGG + Intergenic
1153498014 18:5720236-5720258 GACTTTTCTCCATGAACAGCTGG + Intergenic
1153979648 18:10297949-10297971 GGTCTTTCTCAGGAAACAGCAGG - Intergenic
1154043496 18:10882316-10882338 GGCCTTTCTCCAGTTACCCCCGG + Intronic
1156150243 18:34233488-34233510 GGCCATTCTCCTGCCTCAGCTGG - Intergenic
1156257327 18:35410483-35410505 TACCTTTCTCCAGGAACAGTGGG + Intergenic
1158398211 18:57096309-57096331 GGGCTTTCTCCATCAGGAGCTGG - Intergenic
1159005290 18:63005204-63005226 GTCCTTTCTTCAGCAAGAGCTGG - Intergenic
1160276708 18:77443930-77443952 GGAATTTTTCCAGCAACAGAAGG + Intergenic
1160774821 19:850621-850643 GGCCTGTCTCCAGGAATAGGCGG - Intergenic
1161518877 19:4712633-4712655 GGCTGTTCTCAAGCTACAGCAGG - Intronic
1164617834 19:29677303-29677325 GGTCTTGCTCCCGCACCAGCTGG + Intergenic
1164646318 19:29860980-29861002 GGCCCATCTTCAGGAACAGCTGG - Intergenic
1165433523 19:35785008-35785030 GGGCTTCCTCCAGCGTCAGCAGG - Exonic
1167416505 19:49375983-49376005 GGCCTCTCTCCAGTTACTGCAGG + Intergenic
1167681096 19:50921929-50921951 GGCCATAATCCAGCATCAGCAGG + Intergenic
1168201940 19:54821919-54821941 TGCTTTTCTCCATCATCAGCAGG - Intronic
925006522 2:447362-447384 AGCCTTTCCCCAGGCACAGCTGG + Intergenic
925309846 2:2874792-2874814 GGCCATTCACCAACAACAGTTGG - Intergenic
925377882 2:3401121-3401143 GGCCTTGCTCCAGGAGCTGCTGG - Intronic
926615289 2:14991231-14991253 ACCCTTTCTCCATCAACGGCAGG + Intergenic
926803877 2:16686642-16686664 GGCATTTCTGCAGCACAAGCTGG + Intergenic
927494389 2:23542804-23542826 GGCCTTTCACCAGGGACACCTGG + Intronic
928376847 2:30782016-30782038 GACCTTTCTCCAGGCAAAGCTGG + Intronic
929556564 2:42929214-42929236 GGCCCTTCTCAGGCGACAGCTGG - Intergenic
932087320 2:68774124-68774146 AGCCTTCCTCCAGCAACACTTGG + Intronic
934866189 2:97814317-97814339 GGCCTTTCCACAGGATCAGCAGG + Exonic
936678027 2:114738316-114738338 GGCCTTTCTCGGGCATGAGCAGG + Intronic
936861549 2:117026342-117026364 TGCCTTTCTCCCCCAACAGCAGG - Intergenic
938387218 2:130875471-130875493 CCCCTTTCTGCATCAACAGCTGG + Intronic
939307673 2:140430146-140430168 TGCCTCTCACCAGCAAAAGCAGG + Intronic
940235431 2:151506306-151506328 AGTCTTTCTCCAGGAACTGCTGG - Intronic
944284913 2:197938614-197938636 GCCCTTTCCCCACCAACTGCTGG - Intronic
947089271 2:226492521-226492543 GGCTTTTCTACGGGAACAGCAGG + Intergenic
947612983 2:231535356-231535378 GGCCTATCAACAGCAACTGCTGG + Intergenic
947623296 2:231604482-231604504 GGGCTTTCTCCGGCCACAGGCGG + Intergenic
947797010 2:232901087-232901109 CGCCTTTCTCCATCAGGAGCAGG - Intronic
948481452 2:238253025-238253047 GGGCTTCCTCCAGCTGCAGCAGG + Exonic
948869812 2:240792240-240792262 GCCCTTTCTCCAGCAGAATCGGG - Intronic
1170749647 20:19134155-19134177 GACTTTCCTTCAGCAACAGCTGG + Intergenic
1171382166 20:24742257-24742279 GACCTTCCTCCAGGCACAGCAGG + Intergenic
1171969469 20:31554756-31554778 GGCCTTTCTCCAGCAGATCCTGG - Exonic
1173837133 20:46133341-46133363 GCCCTTTCTCCAGCCCCTGCGGG - Intergenic
1175584340 20:60126093-60126115 ATCCTTTCTCCTGCAGCAGCAGG - Intergenic
1175871610 20:62211927-62211949 GCCCTGTCTCCTGCAACAGAAGG + Intergenic
1179186688 21:39090381-39090403 GGCCTATCTCAGGCCACAGCTGG + Intergenic
1179715083 21:43282283-43282305 GCCCTTGCCCCAGCCACAGCAGG + Intergenic
1181637586 22:24181546-24181568 GGGCTGTCGCCAGCAGCAGCAGG - Exonic
1182524266 22:30905936-30905958 GGCCCTTCTCCATCAGCCGCTGG - Exonic
1182704941 22:32271155-32271177 TGCCATTCTCCTGCAACAGCAGG - Intergenic
1183112227 22:35658853-35658875 GCCCTTGCCCCAGCAACAGGAGG + Exonic
1183616150 22:38946965-38946987 AGCCCTTCCCCAGCAGCAGCTGG - Intergenic
1185106151 22:48871101-48871123 GATCTTCCTCCAGCAGCAGCGGG + Intergenic
949733963 3:7148863-7148885 TGCATTTCTGCAGCACCAGCTGG - Intronic
950582316 3:13870681-13870703 GGCCTTTCTCTAGCAGCACTTGG - Intronic
954199857 3:49017802-49017824 GACCTTCCTGCAGCAACTGCGGG - Exonic
954618874 3:51984479-51984501 GGCCTTTGTCCAGCCCCAGTGGG - Intronic
954663353 3:52237710-52237732 AGCCTTTCTCCAGGAGGAGCTGG - Intronic
956337370 3:68178864-68178886 AGCCATTCTCCACCACCAGCTGG - Intronic
957065094 3:75515326-75515348 TTCCTTTCTCGAGGAACAGCAGG + Intergenic
958110135 3:89131930-89131952 GGCCATTTTCCAGGAACACCTGG - Intronic
961091271 3:124114617-124114639 AGGCATCCTCCAGCAACAGCGGG + Intronic
961110217 3:124277286-124277308 AGCCTTTCTCCAAAAAAAGCAGG - Intronic
961288236 3:125824075-125824097 TTCCTTTCTCAAGGAACAGCAGG - Intergenic
961486213 3:127218574-127218596 TGCCTTTTTCCAGGAACAGCAGG - Intergenic
961635335 3:128329550-128329572 AGCCTTACTCCAGCTAGAGCAGG - Intronic
961654107 3:128432296-128432318 GCCCATTCTCCTGCAGCAGCCGG - Intergenic
961818056 3:129561421-129561443 GGCCTCTCTCCAGCTGCCGCAGG + Intronic
961898814 3:130191975-130191997 TTCCTTTCTCGAGGAACAGCAGG + Intergenic
962630317 3:137269304-137269326 GACCTTACTCCAGCAACCTCAGG - Intergenic
967241664 3:187445539-187445561 ACCCTTTCACCAGCAGCAGCCGG - Intergenic
967947727 3:194817589-194817611 GGCCTTACTCCAGCTCCAGGTGG + Intergenic
968508750 4:985599-985621 GAACTGTCTCCAGGAACAGCGGG - Intronic
968548343 4:1210019-1210041 GGCCTGTCTCCAGCTGGAGCTGG + Intergenic
969744556 4:9059834-9059856 TTCCTTTCTCGAGGAACAGCAGG - Intergenic
969803967 4:9591948-9591970 TTCCTTTCTCGAGGAACAGCAGG - Intergenic
975177250 4:71301856-71301878 GGCATTTCTCGAGAACCAGCTGG - Intronic
979799533 4:124891468-124891490 GGCCTCTCTCCAGCCACAATGGG - Intergenic
981568469 4:146126296-146126318 GGCATTACTCCAGGTACAGCGGG + Intergenic
982275132 4:153630460-153630482 GGCATTACTCCAGGTACAGCAGG + Intronic
985261399 4:188118217-188118239 GGACTTACACCAGCAGCAGCCGG - Intergenic
985632190 5:1019516-1019538 AGCCTCTCGCCAGCCACAGCAGG + Intronic
988580149 5:32461673-32461695 GGCCCTTTTCCAGTAACAGTGGG - Intergenic
988826836 5:34944909-34944931 GGCCTTGCTAAAACAACAGCTGG + Exonic
991982310 5:72245253-72245275 GGCCTTTACCTAGGAACAGCAGG + Intronic
992690418 5:79236204-79236226 GGGCTTTCTGCAGCAGCACCAGG + Exonic
994057460 5:95434372-95434394 GGCCTTTCTCCAGCAACAGCAGG + Intronic
994692179 5:103033016-103033038 GGCCTTCTTCCAGTAACTGCAGG + Intergenic
996370306 5:122746274-122746296 GTCTTTTGTCCAGCAAAAGCCGG - Intergenic
998253125 5:140565899-140565921 GGCATTTCTCAAGAACCAGCTGG + Exonic
998284968 5:140850433-140850455 GGTCTTTCACCAGCACCAGTAGG - Exonic
998286195 5:140863130-140863152 GGTCCTTCACCAGCACCAGCAGG - Intronic
998287525 5:140877410-140877432 GGTCCTTCACCAGCACCAGCAGG - Exonic
1000635269 5:163636888-163636910 AGCCTCCCTCCAGCAACTGCTGG - Intergenic
1004257409 6:14077946-14077968 GACCCTTTTCCAGTAACAGCTGG + Intergenic
1006669730 6:35722502-35722524 GACCTTTATCCTGCAGCAGCCGG - Intronic
1007575521 6:42923197-42923219 GGCCCTTCCCCAGCAACGGATGG + Exonic
1008740107 6:54596512-54596534 CCCCTTTCTCCAGCAACAACTGG + Intergenic
1013479029 6:110536660-110536682 GGCATTTCTACAGAAACAGAAGG + Intergenic
1013655983 6:112246884-112246906 AGCCTTTCCCCAGCAATAGGAGG - Intronic
1017076620 6:150624708-150624730 GGCCTCACTTCAACAACAGCAGG + Intronic
1017485807 6:154900915-154900937 GGCCTTGCTCCTGTAACTGCAGG + Intronic
1018001956 6:159587370-159587392 GGCCTTTCTCCAGGGAGAGAAGG - Intergenic
1019860575 7:3654652-3654674 GCCCTTTCTCCTGAAGCAGCAGG - Intronic
1020364352 7:7364479-7364501 GGACTTTCTACAGCAGCAGATGG - Intronic
1021231171 7:18087238-18087260 GGCTTTCCTCAAGCACCAGCCGG - Intronic
1023401013 7:39793048-39793070 GGCTGTTCTCCAGCCAGAGCTGG - Intergenic
1024648619 7:51387729-51387751 GGCTGTTCTCCAGCCAGAGCTGG + Intergenic
1025098593 7:56116543-56116565 TACCCTTCTCCAGCAACAACAGG - Intergenic
1025175985 7:56802705-56802727 GGCTGTTCTCAAGCCACAGCTGG + Intergenic
1025695390 7:63771936-63771958 GGCTGTTCTCCAGCCAGAGCTGG + Intergenic
1025695809 7:63773717-63773739 GGCTGTTCTCAAGCCACAGCTGG - Intergenic
1026935539 7:74253049-74253071 GGCCGTGCTCCAGCAGCAACAGG - Intronic
1028251423 7:88543440-88543462 GGCCTTTAACCAGCTAAAGCAGG - Intergenic
1028667015 7:93357359-93357381 GACATTTCCCCAGCAGCAGCAGG + Intronic
1029068766 7:97877976-97877998 TTCCTTTCTCAAGGAACAGCAGG + Intergenic
1030860988 7:114628638-114628660 AGCCCTTCTCCAACAACAGCAGG + Exonic
1031869291 7:127074808-127074830 TGCCTTCCTCCTGCCACAGCTGG + Intronic
1032037583 7:128531526-128531548 GGCCTTTGTCCAGCGCCAGGAGG + Intergenic
1032144651 7:129368135-129368157 GGACTTTCTGCAGCAATAGTTGG - Intronic
1033022538 7:137740816-137740838 GGCTTTTCTCATGCAAAAGCTGG + Intronic
1033031294 7:137829862-137829884 GGCATTTCTCCACTAGCAGCAGG + Intronic
1034111340 7:148540674-148540696 TGCCTTTCTCCAGGCACAGCAGG - Intergenic
1035067249 7:156115737-156115759 GGCCTCTCTCCAGCGTCTGCTGG - Intergenic
1036789078 8:11705610-11705632 GGGCTTTCTCCGCCAACTGCAGG + Intronic
1037598624 8:20374766-20374788 GGCCTTCCTCCAGACACAGCTGG + Intergenic
1037740822 8:21607926-21607948 GGCCCTTCTCCCGCCACATCAGG - Intergenic
1039435523 8:37556885-37556907 GGCCCTTCACCAGCACCAGCTGG - Intergenic
1040943159 8:52853090-52853112 GCCATCTCGCCAGCAACAGCTGG + Intergenic
1041740182 8:61149730-61149752 GGACTGTCTCCAGAAAGAGCTGG - Intronic
1043695364 8:83209607-83209629 GCCCTTTCTGCTGCAGCAGCTGG + Intergenic
1047239386 8:123072641-123072663 GGCCTAGGTCCAGCACCAGCAGG - Intronic
1047601983 8:126434791-126434813 GGACTTTCTCCAGCAACAGGGGG - Intergenic
1048850436 8:138640473-138640495 AACCTTTCTCCACCAATAGCTGG + Intronic
1049098330 8:140561885-140561907 GGCCTTGCTCCTGCAACAGCGGG + Intronic
1049183211 8:141234199-141234221 TGCCTTCCACCAGCACCAGCAGG - Intronic
1049236331 8:141514213-141514235 GGCCTTGATCCAGCCTCAGCTGG - Intergenic
1049238042 8:141522485-141522507 AGCTTTTCCCCAGCACCAGCTGG + Intergenic
1049488228 8:142877390-142877412 GGCCTTTGTCCAGCACCTGGAGG - Intronic
1049774301 8:144397495-144397517 TGCCATTCTCCCGCACCAGCAGG + Exonic
1051612128 9:18971149-18971171 GGCCTTTCTGCAGCAGCAAGTGG + Intronic
1051960325 9:22752953-22752975 GGCTTTTCTCCTGGAACAGGAGG - Intergenic
1052796692 9:32929828-32929850 GGCCTCGCTCCAGCCACAGATGG + Intergenic
1053459592 9:38258123-38258145 GGCCTTTCTGCAGCCACTGCTGG + Intergenic
1055520939 9:77080527-77080549 GGAATTTCTACAGCAGCAGCCGG + Intergenic
1055846081 9:80564780-80564802 GGCCTTTCTCCCCCAACGGTGGG + Intergenic
1056693908 9:88830267-88830289 GTCCTTTCTCCAGCCCCACCTGG - Intergenic
1057487174 9:95494679-95494701 GGCCACACTCCAGCAGCAGCAGG + Intronic
1061845418 9:133385421-133385443 GTCCTGTCTCCAGCATGAGCTGG - Intronic
1185952285 X:4450481-4450503 TGGGTTTCTCCAGCAACAGAAGG + Intergenic
1188980318 X:36721253-36721275 GGCGTCTCTCCAGCATCTGCAGG + Intergenic
1189051678 X:37651988-37652010 GACCTGTCTTCAGCAGCAGCTGG + Intronic
1189056262 X:37702151-37702173 GGCCTCTCTCCAGCAGCTTCAGG - Intronic
1189083223 X:37995585-37995607 GGCCTCTCTCCAGCATCTACAGG + Intronic
1190258521 X:48783132-48783154 GCCCTGCCTCCAGCAAGAGCTGG - Intergenic
1196007772 X:110853911-110853933 TTCCTTTCTCCGGGAACAGCGGG + Intergenic
1201243113 Y:11977587-11977609 GGCCATTCTCAAGCAAAAGAGGG - Intergenic
1201738888 Y:17302572-17302594 TGGCTTTCTCCAGCAAGAGAAGG + Intergenic