ID: 994064341

View in Genome Browser
Species Human (GRCh38)
Location 5:95519378-95519400
Sequence CTGGACTCCATGAGTAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994064341_994064346 28 Left 994064341 5:95519378-95519400 CCTTTTCTACTCATGGAGTCCAG 0: 1
1: 0
2: 0
3: 15
4: 165
Right 994064346 5:95519429-95519451 AGAAATAATATTAATTATTGTGG 0: 1
1: 0
2: 4
3: 78
4: 918

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994064341 Original CRISPR CTGGACTCCATGAGTAGAAA AGG (reversed) Intronic
900710344 1:4109434-4109456 CTGGACTTCATGAGAAAATAGGG + Intergenic
907811286 1:57872803-57872825 CTGGACTTCATGTTTGGAAAGGG + Intronic
908010870 1:59776462-59776484 CTAGACTCCAAGAGTGGAAGAGG - Intergenic
908941546 1:69441013-69441035 CTGGCCTCCATAACTATAAAAGG - Intergenic
909018123 1:70401401-70401423 GTGGAACCCATGAATAGAAATGG - Intergenic
913264523 1:117031415-117031437 CTGCCTCCCATGAGTAGAAAAGG + Intronic
913323558 1:117606817-117606839 GTGGACACCATGAGCAGCAAAGG + Intronic
919750891 1:201037485-201037507 GTGTACTACATGAGAAGAAAGGG + Intergenic
1064016159 10:11773966-11773988 CTGGTCACCATGAGGAGAAGAGG + Intergenic
1064570766 10:16690621-16690643 ATGGACTCCAAGAGGAGACATGG - Intronic
1065290929 10:24228562-24228584 CTGGAATCCATGTGTTGAGATGG - Intronic
1065295070 10:24266477-24266499 CTGGACTTCCTGGGTAGAATGGG + Intronic
1068042250 10:51839946-51839968 CTGAACTCCATTAGTTAAAATGG - Intronic
1068057700 10:52031859-52031881 CTGGATTTTATAAGTAGAAATGG + Intronic
1069350140 10:67515867-67515889 CTGGACTGAATGAGTACTAAGGG - Intronic
1069607518 10:69749139-69749161 CTGGGGACCATGAGCAGAAAAGG - Intergenic
1070816585 10:79328366-79328388 CTTGACTCCAGGAGCAGAAGGGG + Intergenic
1071831288 10:89374857-89374879 CTGGGCTCTATGTGTAGATATGG + Intronic
1072272506 10:93790481-93790503 CTGGACCTCATGAGAAAAAAGGG - Intronic
1072864055 10:99039788-99039810 TTGGAATCAATCAGTAGAAAGGG + Intronic
1074731702 10:116384948-116384970 CTACACTCCTTGAGAAGAAAGGG + Intergenic
1074872698 10:117589562-117589584 CAGGACTCTCTGAATAGAAATGG - Intergenic
1074912210 10:117921626-117921648 CTGGATACCATGAGGAGAGAAGG - Intergenic
1078635212 11:13043209-13043231 CTGGAATTCAGGAGGAGAAATGG + Intergenic
1080516115 11:33021927-33021949 TTGGCCTCAATGAGTAGAAAAGG - Intronic
1082787786 11:57326401-57326423 CAGGATCCGATGAGTAGAAACGG - Exonic
1085904066 11:80738706-80738728 CGGGCCTACATGTGTAGAAACGG + Intergenic
1086132066 11:83411196-83411218 TTGCACTTCATGAGGAGAAAGGG - Intergenic
1086212337 11:84335616-84335638 GTGTACTCCATGAGTGAAAAAGG - Intronic
1087727366 11:101737378-101737400 CAGTTCTCCATGAGTAGGAAGGG + Intronic
1090794456 11:130122851-130122873 CTGGCCTCCTAGAATAGAAATGG + Intronic
1093090149 12:14911473-14911495 ATGGTCTCCATGGGAAGAAATGG - Intergenic
1093862828 12:24188789-24188811 CTGTAATTCATTAGTAGAAATGG - Intergenic
1094489571 12:30950728-30950750 CTGGAAACCATGGGTTGAAAAGG - Intronic
1107162080 13:37241992-37242014 CTGATTTCCAGGAGTAGAAATGG + Intergenic
1107724764 13:43287474-43287496 CTGGTCTCCAGGAGAAGAACTGG + Intronic
1107802124 13:44118408-44118430 CTAGAATCCAGGAGGAGAAAGGG - Intergenic
1108286885 13:48917656-48917678 GTGGCCTCCAGAAGTAGAAAAGG - Intergenic
1110386938 13:74923306-74923328 CTGAACTACAGGAGTAAAAAGGG + Intergenic
1111438372 13:88242743-88242765 CTGGAATCCAAGATTAGAAAGGG - Intergenic
1112207218 13:97336718-97336740 CTGGCCTCCAGGACTATAAAGGG + Intronic
1114301839 14:21385486-21385508 CAGGACTCCAGGAGGTGAAAAGG - Exonic
1115449320 14:33527920-33527942 CTGGATTCCTTGTGTTGAAATGG - Intronic
1116003052 14:39264956-39264978 CTGTCCTCCATAAGTAGACATGG - Intronic
1116044915 14:39732616-39732638 CTGGACTCTATGGTTAGATAAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1120491778 14:85187311-85187333 CTGGATTCAATTAGTACAAATGG - Intergenic
1121031874 14:90665032-90665054 CTGGACTCCACAAGTGGAAAAGG - Intronic
1124821009 15:33045306-33045328 CTGGACTCCATGCCTACCAAGGG - Intronic
1125977371 15:43966643-43966665 CTGGATTCCAAGAGGAGAAATGG + Intronic
1126162912 15:45630681-45630703 CTGGATGCCTTAAGTAGAAAAGG - Intronic
1126688839 15:51271664-51271686 CTTGACTCAGTGAGTAGATATGG - Intronic
1127006453 15:54576022-54576044 GTTGACTCCAAAAGTAGAAATGG + Intronic
1129833247 15:78684127-78684149 TTGGACTCAATGATTAAAAATGG + Intronic
1131920860 15:97327185-97327207 CTGGGATATATGAGTAGAAATGG + Intergenic
1134601155 16:15534706-15534728 CTGGACCCCGTGTGTGGAAAAGG - Intronic
1135617381 16:23923476-23923498 CGGAACTCCAAGAGTAGATAAGG - Intronic
1138263750 16:55644459-55644481 CTGGACTTCATGGCTAGAGAGGG - Intergenic
1138764885 16:59590535-59590557 CTGGAGAATATGAGTAGAAATGG + Intergenic
1139249927 16:65485538-65485560 CTGGTCTCCATGAATGGAAAAGG - Intergenic
1144155808 17:12500228-12500250 ATGTAATCCATGAGTCGAAAAGG + Intergenic
1144194933 17:12882867-12882889 CTGGATACCATAATTAGAAAAGG - Intronic
1152376110 17:79919829-79919851 CTGGGCCCCTAGAGTAGAAAGGG + Intergenic
1155231991 18:23783128-23783150 CTGGCCTCCTTGAGGACAAAAGG - Intronic
1155425580 18:25703231-25703253 CTGGAAGCCATGATAAGAAAAGG - Intergenic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1158105810 18:53883850-53883872 CTGGACACCAAAAGAAGAAAAGG + Intergenic
1161225121 19:3140882-3140904 CTGCCCTCCATCAGTAGAAGGGG - Intronic
1166249286 19:41556048-41556070 CTGGACTCCACAAGGAGAACAGG + Intronic
1166712368 19:44945553-44945575 CAGGAATCAATGAGTAGAAGAGG + Intronic
1167353691 19:48991309-48991331 CTGGATTCCATGAACAGCAAGGG - Exonic
927510184 2:23639469-23639491 CTGGAGTCCTTGAGTAGCAGAGG - Intronic
928334799 2:30388486-30388508 CAGGACTCAATGATCAGAAAAGG - Intergenic
932452805 2:71826289-71826311 CTGAAGTCCATAAGAAGAAAAGG + Intergenic
933924772 2:87081531-87081553 CTGGACTTCATGAGTGGTGAAGG - Intergenic
934047957 2:88187347-88187369 CTGGACTCCAGGAGGACAGAAGG + Intergenic
935456296 2:103270962-103270984 CTGGAAGCCATGAGTAGTTATGG - Intergenic
937467925 2:122151262-122151284 CTGGACTCTAAGGGCAGAAATGG + Intergenic
938287840 2:130132400-130132422 CTGGACAACATGAGTACAGAAGG - Intergenic
938553001 2:132397975-132397997 CTGAACACCTTGATTAGAAAGGG + Intergenic
938731859 2:134152877-134152899 GTGGACTCCATGCCTGGAAAGGG - Intronic
942653065 2:178188877-178188899 CTGGTCTCCCTGACTGGAAAAGG + Intergenic
943871967 2:193011498-193011520 CAGGAATCTATGAGAAGAAATGG + Intergenic
945923248 2:215777827-215777849 CTGGGCTCCATGTGTCAAAAAGG + Intergenic
946015288 2:216599348-216599370 CTGCACTCCATCAGTAGCCAAGG - Intergenic
1169029273 20:2395414-2395436 CTGCACACCATGGGTTGAAAAGG - Exonic
1171482414 20:25464032-25464054 CTTGATTTCATGAGTAGAAATGG + Intronic
1172197780 20:33103871-33103893 CTGGACTCCAAGTGAAGAAAGGG + Intronic
1172571878 20:35976918-35976940 CTGGGCTCCAAGAAGAGAAAGGG - Intronic
1172593484 20:36133465-36133487 CATGATTCCATGAGGAGAAATGG + Intronic
1172924490 20:38519661-38519683 CTGAACACAATGAGGAGAAAAGG - Intronic
1173007207 20:39149352-39149374 CTGGGCTCCAGGAAGAGAAATGG - Intergenic
1177731089 21:25027168-25027190 CAGGAATCAAGGAGTAGAAATGG + Intergenic
1180937594 22:19636321-19636343 CTGAACTGCATGCTTAGAAATGG + Intergenic
1182152017 22:28034511-28034533 CCAGAGTCCAGGAGTAGAAAGGG - Intronic
1184824087 22:46935326-46935348 CTGGAGTACATGAGAAAAAATGG + Intronic
949366691 3:3289495-3289517 CTGTACTTCATGAGTCTAAAGGG - Intergenic
949694765 3:6681473-6681495 TTGGACACTAGGAGTAGAAAGGG + Intergenic
951425254 3:22537191-22537213 CTCAACTCCATGAGTAGTCAGGG + Intergenic
951735569 3:25859375-25859397 CAGGACTCCATGAGAAAGAAAGG - Intronic
952601117 3:35084438-35084460 CAGTATTCAATGAGTAGAAAGGG - Intergenic
953753589 3:45628185-45628207 GTGGACTCCCTGAGTTGAAAAGG + Intronic
954454572 3:50590794-50590816 AAGTACTCCATGAGTAGACATGG + Intergenic
955491121 3:59484046-59484068 CTGGACTCAAACAGAAGAAATGG + Intergenic
957856074 3:85880623-85880645 CTGGCCTCCATGACTTGAAATGG + Intronic
960121749 3:113954166-113954188 CTGGAGTGCCTGAGCAGAAAAGG + Exonic
960339111 3:116453701-116453723 CTGGACTTCAAGAAAAGAAAAGG - Intronic
962169509 3:133086158-133086180 CTGGACTCCAGAAGCAGAAAAGG - Intronic
963145142 3:141986172-141986194 CAGGACTACATAAGAAGAAAAGG - Intronic
964628155 3:158779088-158779110 CTGGATTCCATCAGTTGAAGAGG + Intronic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
973978905 4:56289967-56289989 TTGGACTCCATGAGCACAGAGGG + Intronic
974261107 4:59525089-59525111 ATGCACCACATGAGTAGAAATGG - Intergenic
975979725 4:80143883-80143905 CTAGAAGCCATGAGCAGAAATGG - Intergenic
977752969 4:100631886-100631908 CTGGAATCAAGGAGTGGAAATGG - Intronic
979817094 4:125122555-125122577 CTGGACTGTAGGAGTAGAAATGG + Intergenic
979827831 4:125261413-125261435 CTGGACACCAAAAGAAGAAAGGG - Intergenic
980806661 4:137824304-137824326 CTTGAAACCATGAGGAGAAATGG + Intergenic
982205221 4:152992660-152992682 CTGGACTGCAGGAGCAGAAGAGG + Intergenic
982243771 4:153328009-153328031 CTGGACTCCATACTTAGAATGGG - Intronic
983297396 4:165883268-165883290 CTGGACTCCATGAGCTGCCATGG + Intronic
983325372 4:166248626-166248648 CTGGACTTCGGGAGTAGAGATGG + Intergenic
984053834 4:174900904-174900926 CTGAAATCCAGGAGTTGAAAGGG - Intronic
985136949 4:186795555-186795577 CTGAACTCCATAACTTGAAATGG + Intergenic
987495829 5:18643384-18643406 CTGGCCTCCATGGAGAGAAATGG + Intergenic
993090062 5:83414368-83414390 GTCTACTCCATGAATAGAAATGG - Intergenic
993687934 5:90963656-90963678 CTGGAGTCTTGGAGTAGAAAGGG + Intronic
994064341 5:95519378-95519400 CTGGACTCCATGAGTAGAAAAGG - Intronic
996367181 5:122715617-122715639 GGGGACTCCAAGAGGAGAAAGGG + Intergenic
998996305 5:147871904-147871926 CTGTAGTCCAGGAGTAGACAGGG + Intronic
999159732 5:149485368-149485390 CTAGACTCTATGAGTACAAGGGG + Intergenic
1000937978 5:167326167-167326189 CTGGACTTCATGACAAGACAGGG + Intronic
1003565179 6:7216480-7216502 CTCGGCTCCATGAGTAGTGAGGG + Intronic
1005914661 6:30341933-30341955 CGGGACTCCGTGAGCCGAAAGGG + Exonic
1006013725 6:31063991-31064013 CTGGACTTCATAAAGAGAAAAGG - Intergenic
1011755123 6:90490950-90490972 CTGAACTTCCTGAATAGAAAAGG - Intergenic
1013658008 6:112265567-112265589 TTGAACTCCATGAGAAGAGAAGG + Intergenic
1017729539 6:157302964-157302986 CTGGACTCCCGGAGAGGAAAAGG - Intronic
1018206915 6:161445044-161445066 CTGGATTCCAAGAGTAGACTGGG + Intronic
1018215600 6:161524186-161524208 GTGGACTCCCTGAGCAGCAAGGG + Intronic
1021640110 7:22728265-22728287 CTGGACTCCATCAGTAAAATTGG + Intronic
1024567684 7:50695596-50695618 CTGGACTCCGTGAGTTCTAATGG + Intronic
1024724125 7:52172904-52172926 CTGGATTTCATGAGGAGAGAGGG - Intergenic
1026389233 7:69883030-69883052 CTGTATTCCAGGAGAAGAAATGG + Intronic
1030062267 7:105631906-105631928 CTGGAAGCCCTGACTAGAAATGG - Intronic
1030471126 7:109963548-109963570 CTGGATTCCAGGAGAGGAAAAGG - Intergenic
1031711620 7:125053921-125053943 CTGAACTGCATGAGTAAAGATGG + Intergenic
1033825868 7:145188100-145188122 GTGGACTGCTAGAGTAGAAATGG - Intergenic
1034131585 7:148723134-148723156 CTGGAAGCCAAGAGAAGAAAAGG - Intronic
1037491946 8:19404632-19404654 CTGGCTTCCATAAGAAGAAATGG - Exonic
1038880209 8:31602584-31602606 GTGGACTCCCTGAGTAGAAGTGG - Intergenic
1039826360 8:41177307-41177329 CTGAATTCCTTGAGTAGAATGGG + Intergenic
1040593935 8:48819821-48819843 CTGGACTCTGGGAGAAGAAAGGG + Intergenic
1041394760 8:57379082-57379104 CTGGCCCCCATGAGAAGTAATGG + Intergenic
1041966380 8:63683259-63683281 CTGGACTAGATGAATTGAAAGGG + Intergenic
1044754326 8:95445712-95445734 CTGGACAGTATGAGGAGAAAAGG - Intergenic
1046742029 8:117839846-117839868 CTGGACTCTATCTGTTGAAATGG - Intronic
1047421072 8:124708711-124708733 CTGTACCCCTTGACTAGAAAGGG - Intronic
1049312695 8:141941832-141941854 CTGGGCTTCATGTGCAGAAAAGG + Intergenic
1051523575 9:18017507-18017529 TAGGACTCCATGAGTAGAGGGGG - Intergenic
1051930034 9:22374068-22374090 ATTGCCTCCCTGAGTAGAAAAGG - Intergenic
1053617970 9:39788780-39788802 CTGGCCTCCATGACTAGTTAGGG + Intergenic
1053876148 9:42548145-42548167 CTGGCCTCCATGACTAGTTAGGG + Intergenic
1053896506 9:42746488-42746510 CTGGCCTCCATGACTAGTTAGGG - Intergenic
1054235549 9:62553577-62553599 CTGGCCTCCATGACTAGTTAGGG - Intergenic
1054266188 9:62918649-62918671 CTGGCCTCCATGACTAGTTAGGG - Intergenic
1055769241 9:79699465-79699487 CTGGACAACAGGTGTAGAAAGGG + Intronic
1056290302 9:85136367-85136389 CTGGACTTCAAGAGTAGAAGAGG - Intergenic
1060442775 9:123656908-123656930 TTAAACTCCATGAGTAGGAAAGG - Intronic
1062125977 9:134863362-134863384 CTGGGCTCCCTGAGTGGAGACGG - Intergenic
1187125495 X:16450606-16450628 CTGGACTTCATGATTAGTGATGG - Intergenic
1188221317 X:27545123-27545145 CTTGATTCCATGAGTAGCTAAGG + Intergenic
1188236486 X:27738099-27738121 CTGGTCTCCAAGAGTAGTTACGG + Intronic
1188406710 X:29819894-29819916 CTGAACTGGATGAGTACAAAAGG + Intronic
1192896508 X:75447999-75448021 CAGGACTCAAGGAGTAGAAATGG - Intronic
1193508548 X:82372112-82372134 CTGGAGGCCATGTGTAGAATTGG - Intergenic
1197269866 X:124413809-124413831 CTAGAATCCCAGAGTAGAAAAGG - Intronic
1199534478 X:148886597-148886619 CTGGACTTTATGATTTGAAAAGG + Intronic
1200334435 X:155334857-155334879 CTGGGCTCCATGCCCAGAAAAGG + Intergenic
1200743115 Y:6876954-6876976 CATGAACCCATGAGTAGAAAGGG - Intergenic
1201311285 Y:12600265-12600287 CTGGACTCCCTGGGTCGAATGGG - Intergenic