ID: 994070735

View in Genome Browser
Species Human (GRCh38)
Location 5:95599072-95599094
Sequence CAGAGCTAACATTCTAATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 8, 3: 47, 4: 341}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994070735 Original CRISPR CAGAGCTAACATTCTAATGT GGG (reversed) Intronic
901615728 1:10538083-10538105 CAGAGCTTAAATTCTAGTGGAGG + Intronic
902058331 1:13620677-13620699 TAGAGCTTACATTCTAATGCTGG + Intergenic
902577263 1:17386283-17386305 CATAGCTAACATTTCACTGTGGG - Intronic
902592348 1:17484123-17484145 CAGGGCTTCCATTCTAATGTGGG + Intergenic
903488248 1:23707557-23707579 TGGAGCTTACATTCTAATGGAGG + Intergenic
904195132 1:28779780-28779802 TAGAGGTAAAATTATAATGTGGG - Intergenic
904943468 1:34181595-34181617 TAGAGCTCACATTCTAGTATAGG + Intronic
905535312 1:38716799-38716821 CAGAGCAAAGATTCTTATCTAGG - Intergenic
906004244 1:42455595-42455617 AAGATCTAACATTCCAATGTGGG - Intronic
906257773 1:44363624-44363646 TAGAGCTTACATTCGAATGAAGG + Intergenic
906634895 1:47402819-47402841 CAGGGCTCACATTCTAGTGGGGG + Intergenic
906679938 1:47719690-47719712 CAGAGCCAAGGTTCAAATGTAGG - Intergenic
908025445 1:59946505-59946527 TGGAGCTCACATTCTAGTGTGGG - Intergenic
908087566 1:60652705-60652727 CAGAGTTAGCATTCAAATGCAGG - Intergenic
908285852 1:62599559-62599581 CAGAGCTTACATTTTAGTGCAGG - Intronic
908503921 1:64775382-64775404 CAGAGCTCACAATCTAATAGGGG - Intronic
909272223 1:73637836-73637858 CAGAGCTTATATTCCAATGGAGG - Intergenic
910608873 1:89118003-89118025 TAGAGCTTACATTCTAATGATGG + Intronic
910812992 1:91256913-91256935 GAGATCTAACTTACTAATGTAGG - Intergenic
910836910 1:91523186-91523208 CAGAGCTTAAATTCTAGTGAGGG + Intronic
911617915 1:100035551-100035573 CAGAGCTTACATTCTAGTGGGGG - Intergenic
911867724 1:103050126-103050148 CAGGGCCAACATTCAAATTTAGG - Intronic
912446582 1:109740918-109740940 CAGAGCAAACACTCCAAGGTGGG - Intronic
912889683 1:113516239-113516261 CAGACCTTACATTCAAATCTTGG + Intronic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
915072867 1:153286798-153286820 CAGAGCTGACATTCTAGTTGGGG + Intergenic
916143333 1:161718817-161718839 TGGAGCTTACATTCTAATGGGGG + Intergenic
916251265 1:162740677-162740699 CTGAGTTTACATTCTCATGTGGG - Intronic
916611052 1:166392130-166392152 TGGAGCTTACATTGTAATGTGGG + Intergenic
917185287 1:172347078-172347100 CAGACCTTACATTCAAATGGGGG - Intronic
917578381 1:176348471-176348493 CAAAGGTAACATTCTAAGGATGG + Intergenic
917958432 1:180124060-180124082 AAGAGCTTACATTCCAGTGTAGG + Intergenic
918138851 1:181702930-181702952 CAGAGCTTACATTATACTGCAGG - Intronic
918859017 1:189797761-189797783 TAGAGCTTACCTTCTAATGTAGG + Intergenic
919659523 1:200230190-200230212 TTGAGCTAACATTCTAATGATGG - Intergenic
921145929 1:212356342-212356364 CAGAGCTTACGTTCTAATGGAGG - Intronic
921563394 1:216686149-216686171 CAGAGGTGACATTATATTGTTGG + Intronic
923336116 1:232971645-232971667 TGGAGCTTACATTCTAATGGAGG + Intronic
923441811 1:234027825-234027847 CAGAGCTTTCATTCTAAGGAGGG + Intronic
923840350 1:237664365-237664387 AGGAGCTTACATTCTAATGGGGG + Intronic
1064328557 10:14373102-14373124 CAGAGCTCCCAGTCTAGTGTGGG - Intronic
1064458067 10:15507278-15507300 CAGAACTGACATTCAAATCTAGG - Intergenic
1065353037 10:24812582-24812604 CAGAGCTTCCATCCTCATGTAGG + Intergenic
1066310789 10:34194022-34194044 GAGAGATAAAATTTTAATGTTGG - Intronic
1067255731 10:44637933-44637955 CAGAACTGACAAGCTAATGTAGG - Intergenic
1068494010 10:57762241-57762263 CAGAGCTTACATTTTAGTGAGGG - Intergenic
1068984187 10:63091841-63091863 CAGAGCTTACATTATAGTGTGGG + Intergenic
1069741872 10:70690015-70690037 CGGAGCTAACATTCTACAGCAGG - Intronic
1070076657 10:73143026-73143048 TAGAGCTTACATGCTAATGTAGG - Intronic
1070654896 10:78264644-78264666 CAGAGCTGAGATTCTAATGTGGG - Intergenic
1070691856 10:78532975-78532997 AAGAGCTTACAGTCTAATGAGGG + Intergenic
1071310286 10:84336905-84336927 CAGAGCCAACAATTTAATGATGG + Intronic
1071767580 10:88685935-88685957 CAGAGCTTACATTTTAGTGGTGG + Intergenic
1071982063 10:91013369-91013391 AAGAGCTTACAGTCTAATGAGGG + Intergenic
1072210749 10:93244655-93244677 CAGAGCTCGCTTTCTAATGCGGG - Intergenic
1072350016 10:94547783-94547805 CAGAGCTAACATTCCAGTGTAGG + Intronic
1073489378 10:103842755-103842777 TAGAGCTTACATTCTGGTGTGGG - Intronic
1074066267 10:110017233-110017255 CAGAAATATCATTCTAATCTTGG - Intronic
1075986809 10:126795126-126795148 CACAACTAACATTCAAATTTTGG + Intergenic
1077821060 11:5741034-5741056 GAGAGCTAACACTCTCATGCAGG + Intronic
1077939651 11:6827175-6827197 CAGAGCAAGGATTTTAATGTAGG + Intergenic
1078396734 11:10988118-10988140 CAGAGCTTACATTCTAGAGGAGG - Intergenic
1078469259 11:11573992-11574014 AAGAGCTGACATTCAAATCTAGG + Intronic
1078866368 11:15301856-15301878 AAGAGGTCACATTCTAATGGTGG + Intergenic
1079057354 11:17217859-17217881 TTGAGCTTACATTCTAGTGTGGG - Intronic
1080055376 11:27901237-27901259 AGGAGCTCACAGTCTAATGTGGG + Intergenic
1080060648 11:27953168-27953190 CGGAGCTGACAATCTAATGAAGG + Intergenic
1081420172 11:42866752-42866774 CAGAGCTAAGATTCAAATTTAGG - Intergenic
1084875500 11:72129374-72129396 TAGAGCTGACATTCTAGTTTGGG - Intronic
1085794690 11:79528191-79528213 CAGAGCTCACATTCCAGTGAAGG - Intergenic
1086216812 11:84392813-84392835 CAGAGCTAGGATTCTAATTTGGG + Intronic
1087059107 11:93961262-93961284 CAGAACTGACACTCAAATGTAGG + Intergenic
1087343035 11:96933477-96933499 CAGAGCTGACCTTCAAATATTGG + Intergenic
1088071720 11:105794709-105794731 CAGAGCTGACATTCTAATCCAGG + Intronic
1088461367 11:110086821-110086843 GGGAGCTTACATTCTCATGTGGG + Intergenic
1088515652 11:110630340-110630362 GGGAGCTTATATTCTAATGTGGG - Intronic
1088702006 11:112421876-112421898 CAGCGCTAAGATTCAAATGCAGG + Intergenic
1088879983 11:113965499-113965521 TAGAGCTTACATTCTAGTGGAGG + Intergenic
1089061142 11:115627244-115627266 CAGAGCTGAGATTCTAGTCTAGG + Intergenic
1089580855 11:119481342-119481364 CAGAGATTACATCCTAATGGGGG - Intergenic
1089758408 11:120704578-120704600 CAGAGCTTACATTCTAGTAGAGG - Intronic
1089797665 11:120995385-120995407 CAGAGATAACAATCTAATTGAGG + Intergenic
1091214575 11:133892905-133892927 CACAGCCTACATTCTAATGTAGG - Intergenic
1092966873 12:13652469-13652491 AAGTGCTAACAGTCTGATGTAGG + Intronic
1093521638 12:20057891-20057913 AAGAGCTTGCAGTCTAATGTTGG + Intergenic
1094426006 12:30317854-30317876 CAGAGCTTAGTGTCTAATGTGGG - Intergenic
1096428190 12:51521747-51521769 CAGAGCTAAGATTCCAACCTAGG + Intergenic
1096516335 12:52157589-52157611 GGGAGCTAACATTCTAACGGGGG + Intergenic
1097376042 12:58844223-58844245 CAGAGCTTACATGCTAGTGAAGG + Intergenic
1097724648 12:63061253-63061275 CAGAGCTAGGATTTTAATCTGGG - Intergenic
1097754596 12:63395661-63395683 AAGAGATATCATTATAATGTGGG - Intergenic
1098443705 12:70544921-70544943 CAGAGGTTACATTCTCATGGAGG + Intronic
1098823590 12:75265155-75265177 TGGAGCTTACATTCTAATGGGGG - Intergenic
1099628912 12:85114745-85114767 GACAGCCAACATTCTAAAGTGGG - Intronic
1100351346 12:93786277-93786299 CAGAGCTAAGGTTCAAATTTAGG - Intronic
1101329923 12:103749396-103749418 CAGAGCTAAGAAATTAATGTTGG - Intronic
1102516518 12:113452291-113452313 CAGAGCTAATATTCTATGGGGGG - Intergenic
1103506668 12:121445664-121445686 CAGAGCTTACATTTTAGTGGAGG + Intronic
1104278546 12:127352885-127352907 CAAAGCTGACATTCTAGTGGAGG - Intergenic
1104490953 12:129192846-129192868 CAACACTACCATTCTAATGTTGG + Intronic
1105588935 13:21773156-21773178 GAGAGCTTACATTCTAGTGGAGG - Intergenic
1107876444 13:44795115-44795137 AAGGCCTAACAGTCTAATGTAGG - Intergenic
1107938196 13:45362637-45362659 CAGAGCTCACCTTCTAGTGGAGG - Intergenic
1108115037 13:47118305-47118327 TGGAGCTTACATTCTAATGGGGG + Intergenic
1108505474 13:51108750-51108772 CAGAACTAAAATTCAAATCTTGG + Intergenic
1108802048 13:54110164-54110186 TAGAGCTAACATACTTTTGTAGG + Intergenic
1111738443 13:92172031-92172053 CAGAACTAACAATCTATTGTAGG - Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112306817 13:98281901-98281923 CAGATGTGAAATTCTAATGTGGG + Intronic
1112380128 13:98881173-98881195 CAGAGCTAACCTTCCTATCTGGG + Intronic
1115411687 14:33082699-33082721 CAGAGCTGAGATTCTAAACTTGG - Intronic
1115534005 14:34355561-34355583 CTGAGCTAAAAGTCTAATTTTGG - Intronic
1115876644 14:37868922-37868944 CAGAGCTAAGGTTTGAATGTGGG + Intronic
1117491975 14:56257268-56257290 CAGAGCTTACAGTGTAATGTGGG + Intronic
1119533132 14:75377471-75377493 CAGAGCTAATATTTGAATCTGGG - Intergenic
1119607555 14:76033760-76033782 AAGAGCTCAAATTCTAATTTAGG + Intronic
1119672206 14:76528304-76528326 CTGAGCTAAGATTCTGATGTCGG - Intergenic
1119770731 14:77219363-77219385 CAGAGCTCACCTTCTAGTGGAGG + Intronic
1121220420 14:92280781-92280803 CGGAGCTTACATTCTAGTGGGGG + Intergenic
1125360650 15:38860977-38860999 TAGAGCTTACATTCTAGTGTGGG + Intergenic
1125413401 15:39428275-39428297 TAGGGCTTACATTCTAATGGGGG + Intergenic
1126994773 15:54428573-54428595 CAGAGCTTACAGTCTAAGGTGGG - Intronic
1130752306 15:86725109-86725131 CAGAGCTAAAAATTAAATGTGGG + Intronic
1131067138 15:89441773-89441795 CAGAGCTGACATTCTGGTGGAGG + Intergenic
1131664068 15:94551102-94551124 CAGAGCTCACTCTCTAATGGGGG + Intergenic
1133707359 16:8367656-8367678 CAGAGCCAAGATTCCAATGCAGG + Intergenic
1133720491 16:8490072-8490094 CAGAGCTGACATTCTTGTGAAGG + Intergenic
1134080023 16:11318746-11318768 CTGAGCTCACATTCCATTGTGGG + Intronic
1134092896 16:11401012-11401034 GATAGCTCACATTTTAATGTGGG - Intronic
1135662566 16:24309353-24309375 CAGAGCCAGGATTCTAATGCAGG + Intronic
1137762805 16:50954170-50954192 AAGAGCTTACATTCTAATGGGGG - Intergenic
1137875376 16:51991816-51991838 GAGAGCTCACATTCCAATGCAGG + Intergenic
1137905798 16:52320658-52320680 TGGAGCTTACATTCTAATGGAGG - Intergenic
1138423108 16:56912686-56912708 GTGAGCGAACATTCTAATGTGGG + Intronic
1138903659 16:61304165-61304187 GAGAGCTAAAATTCACATGTGGG - Intergenic
1141427231 16:83952191-83952213 CAGAGCTCACATTCTGGTTTGGG + Intronic
1142948199 17:3453529-3453551 CACAGCTAACATCATAATGGGGG + Intronic
1144645575 17:16971461-16971483 CATAGCCAAAAGTCTAATGTGGG + Intronic
1146208634 17:30924757-30924779 CAGAGCTTACATTCTAGTGTGGG + Intronic
1147060512 17:37873566-37873588 GACAAGTAACATTCTAATGTAGG + Intergenic
1147477275 17:40724168-40724190 TAGAGCTTACATTCTAGTGTAGG - Intergenic
1149355848 17:55838540-55838562 CAGAGCTTACAATCTAGTGAGGG - Intronic
1149730749 17:58943819-58943841 TAGAGCTTACATTCTAAAGAAGG - Intronic
1149905669 17:60524889-60524911 CAGTGTTCACATTCAAATGTGGG + Intronic
1150259901 17:63780565-63780587 TAGAGCTAACATTCTACTCAGGG + Intronic
1151121349 17:71796676-71796698 CAGAGCTGACATTCTAGTGGTGG - Intergenic
1154280174 18:12995614-12995636 TAGAGCTTACATTCTAATGTGGG + Intronic
1155966793 18:32043355-32043377 CAGAGCTAACATTTTTCTCTGGG - Intronic
1157091660 18:44643881-44643903 CAGAGCTTACAGTCTACTGTTGG + Intergenic
1157699943 18:49755933-49755955 CTGAGCTTACATTCAAATGGAGG - Intergenic
1158170614 18:54595306-54595328 AAGAGCTAACATTCTAATCGGGG + Intronic
1158325262 18:56307011-56307033 CAGAGGGAACCTTCTAATGAAGG + Intergenic
1158555906 18:58474600-58474622 TAGAGCTTACATTTGAATGTGGG + Intergenic
1158894134 18:61897361-61897383 CAGAACTTACATTCTAATGGAGG + Intergenic
1158926177 18:62263744-62263766 TAGAGCTTACATTCTGCTGTGGG + Intronic
1159114475 18:64098467-64098489 CATAAGTAACATTCTAATTTGGG + Intergenic
1159141612 18:64402422-64402444 CAGAGCTTACCTTCTAGTGAGGG - Intergenic
1159563108 18:70016867-70016889 AAGAGCTTACCTTCTAGTGTGGG + Intronic
1163021060 19:14480932-14480954 CAGAGCTGACACGCTAATGTGGG - Intronic
1163082423 19:14953553-14953575 CAGAGCTTACATTCTAGTATGGG + Intronic
1165547867 19:36556768-36556790 CAGAGCCACCATTCTAGTGCTGG - Intronic
1166251849 19:41576780-41576802 CAGAGCTCACAATCTCATGGGGG + Intronic
1166518882 19:43465983-43466005 CAGAGCTCACAGTCTGATGGGGG + Intergenic
1168487645 19:56778155-56778177 TAGAGCTTGCATTCTAATGGGGG - Intronic
926454493 2:13048409-13048431 TAGAGCTGAAATTCTTATGTTGG - Intergenic
927374023 2:22392413-22392435 TAGAGCTGATATTCTAATGGAGG - Intergenic
928994290 2:37270537-37270559 CAGAACTAATATACTAATTTGGG + Intronic
929311602 2:40432285-40432307 CAGAGCTTATATTCTAATGGTGG + Intronic
930849848 2:55948559-55948581 CAGAAATAATTTTCTAATGTTGG + Intergenic
931653740 2:64491278-64491300 CAGAACTTACATTCTAGTGGTGG + Intergenic
932266569 2:70372363-70372385 CACAGCCAACATTATACTGTGGG - Intergenic
933244919 2:79964383-79964405 GAGAGCCAACATTCAAATATGGG + Intronic
935800258 2:106688820-106688842 TATAGCTTACATTCTAATGCGGG + Intergenic
938575880 2:132604137-132604159 CAGACCTGACCTTCTCATGTGGG - Intronic
939000994 2:136734324-136734346 TGGAGCTTACATTCTAATGGTGG - Intergenic
939548950 2:143589544-143589566 CAGAGCCAACATTCAAGTCTAGG + Intronic
941109703 2:161405835-161405857 CAAAGTTAACATGTTAATGTGGG + Intronic
941350006 2:164420200-164420222 TAAAGCTGACATTCTAGTGTGGG - Intergenic
941660292 2:168189807-168189829 CAAAGCTAAAACTCTATTGTAGG + Intronic
942139328 2:172961878-172961900 CAGAGCTTGTTTTCTAATGTAGG + Intronic
942819526 2:180095583-180095605 GAGATCTAACATTTTGATGTGGG - Intergenic
944185098 2:196939573-196939595 CAGAGACTACATTCTGATGTGGG + Intergenic
944300052 2:198113428-198113450 CAGAGCTGACAGTCTAGTGGGGG + Intronic
944639533 2:201709351-201709373 TGGAGCTTACATTCTAATGGGGG - Intronic
944808094 2:203302228-203302250 CACTGTTAAGATTCTAATGTAGG + Intronic
945250234 2:207759817-207759839 TAAAGCTAACAGTCTAATTTGGG - Intronic
945369718 2:209002530-209002552 CAGAATTAAAATTCTAATTTGGG + Intergenic
946460120 2:219861507-219861529 CAGTGCCAACAATCTAATGTTGG + Intergenic
947164755 2:227250543-227250565 TAGAGCTTACATTCTCATGGGGG + Intronic
1169864228 20:10182898-10182920 TAGAGCTTACATTCTAGTGCAGG - Intergenic
1169870615 20:10244539-10244561 CAGAGCCAAGATTTGAATGTAGG + Intronic
1170036116 20:11992028-11992050 CAAAACTAACATTCTTATGATGG - Intergenic
1170843142 20:19940173-19940195 CAGAGCTTACCTTCTAGTGGTGG - Intronic
1172002382 20:31789223-31789245 GGGAGCTCACATTCTAATGGAGG - Intronic
1172818032 20:37705156-37705178 CAGAGCTGAGATTCCAATGCAGG - Intronic
1173924043 20:46767671-46767693 CAGAGCCAACATTCTAACTCAGG + Intergenic
1174711706 20:52713248-52713270 GAGAGCTTATATTCTAGTGTTGG + Intergenic
1174723628 20:52839106-52839128 TGGAGCTTACATTCTAGTGTGGG + Intergenic
1176883152 21:14222647-14222669 CAGAGCTAACATGCAAATTCAGG - Intronic
1176971245 21:15268485-15268507 CAGAGCTAGGATTCAAAAGTAGG + Intergenic
1177246727 21:18534885-18534907 GAGAGCTAAGGTCCTAATGTAGG - Intergenic
1178087527 21:29126899-29126921 CAGAGCTGACTTTAAAATGTTGG + Intronic
1178373659 21:32048905-32048927 CAGAGCTTACATTCCAGTGACGG + Intergenic
1180939762 22:19651908-19651930 CACAGCTAACATCATAATGGTGG + Intergenic
1181018173 22:20083300-20083322 CAGAGCTCACATTTTAGTGGGGG - Intronic
1183093179 22:35537397-35537419 AAGAGCTCACATGCTAATGGGGG + Intergenic
1184707993 22:46228557-46228579 CAGAGCAAAAATGCAAATGTGGG - Intronic
949577594 3:5353662-5353684 CAGAGCTGAAATTCAAATGTAGG - Intergenic
951208131 3:19946340-19946362 GGGAGCTAAAATTCGAATGTAGG + Intronic
951481553 3:23167271-23167293 TAGAGCTTACATTCTAGTGGGGG - Intergenic
951890503 3:27563809-27563831 TAGAGCTTACATTCTACTGGTGG - Intergenic
952218299 3:31299613-31299635 AAAAGCTCACATTCTAATGAGGG - Intergenic
953668805 3:44945338-44945360 CAGCTCTAACATTCTACAGTGGG + Intronic
954818575 3:53304407-53304429 CAGAGCAAACATTTTGAGGTTGG - Intronic
954886985 3:53883393-53883415 CGGAGCTTACATTCTAGTGTGGG - Intergenic
955669012 3:61382594-61382616 CAGAAAAAACATTCAAATGTAGG + Intergenic
955718162 3:61853094-61853116 CGGAGCTTACGTTCTACTGTGGG + Intronic
956228046 3:66981841-66981863 CAGAACTAAAATTCTCATTTTGG + Intergenic
956944489 3:74204285-74204307 AAGATTTACCATTCTAATGTTGG - Intergenic
957299467 3:78372733-78372755 CAGAGCTAAGATTCAAATCCAGG - Intergenic
957311646 3:78527544-78527566 CAGAGCTCACAATCTAGTGGTGG + Intergenic
957593856 3:82234744-82234766 CAGACCTTACAATCTAATGAAGG - Intergenic
957993502 3:87657591-87657613 TGGAGTTAACATTCTATTGTTGG - Intergenic
958018746 3:87972154-87972176 TAGATCTTACATTCTAATGAGGG + Intergenic
958033761 3:88147167-88147189 CAGAGCTCATATTCTACTGGGGG + Intronic
959682691 3:109113812-109113834 CAGAGCTGGCATTCAAATTTGGG - Intronic
962062898 3:131949853-131949875 CAGTGCTAGCATTTTAATGGAGG - Intronic
962821397 3:139050677-139050699 CACAGCTAACATTATACTGAAGG - Intronic
962958427 3:140287794-140287816 CAGAGCCAGCATTCTAAGATAGG + Intronic
963232814 3:142925991-142926013 CAGAGCCAACAGTCTAACGGGGG - Intergenic
964410987 3:156397880-156397902 AAGAGCTTACATTCTAATTAGGG - Intronic
964591891 3:158373858-158373880 TGGAGTTAACATTCTAAAGTAGG + Intronic
966141089 3:176757110-176757132 TAAAGCTGACATTGTAATGTGGG + Intergenic
966706943 3:182926448-182926470 TGGAGCTTACATTCTAGTGTTGG - Intergenic
967227091 3:187302411-187302433 CAGAGCTTAAATCCTAATCTTGG - Intergenic
967295866 3:187964174-187964196 CACAGCTCACATTGTAATGCTGG - Intergenic
967327610 3:188257863-188257885 CAGAGCCAGGATTCAAATGTTGG + Intronic
968297152 3:197585376-197585398 CGGAGCTTAAATTCTAATGAGGG + Intergenic
969210481 4:5683572-5683594 CGGAGCTGACATTCTAGTGAGGG + Intronic
970268968 4:14322250-14322272 AAGAGCTTATATTCTAGTGTAGG - Intergenic
970953866 4:21787876-21787898 CAGAGCTGACATTCTAGTGGGGG + Intronic
970988713 4:22188631-22188653 CAGACCTTACATTCTAATGTGGG - Intergenic
971088441 4:23309321-23309343 CATTGAAAACATTCTAATGTAGG + Intergenic
971190502 4:24424153-24424175 TAGAGCTGACTTTCTAATTTTGG + Intergenic
971224172 4:24735969-24735991 AAGAACTAATATTCTAATGGAGG + Intergenic
971952380 4:33369985-33370007 TAGAGATTACATTCTAGTGTGGG - Intergenic
972094477 4:35332173-35332195 TGAAGCTTACATTCTAATGTAGG - Intergenic
972177831 4:36428989-36429011 GAGATCTAACATTTTGATGTGGG - Intergenic
972196813 4:36663372-36663394 GACAGTTAGCATTCTAATGTTGG + Intergenic
972256119 4:37357665-37357687 CGGAGCTTACATTCTAATGTGGG + Intronic
973337883 4:48974835-48974857 CAGAGTTTTCATTCTAATCTTGG + Intergenic
973627030 4:52783163-52783185 AAGAGGAAACATTCCAATGTAGG - Intergenic
974158926 4:58112021-58112043 GAAAGCTAACATTGTAATGTTGG - Intergenic
974254037 4:59426128-59426150 CAGATGTAACATTCTAGTTTGGG + Intergenic
974887054 4:67832607-67832629 AAGAGCTTACACTCGAATGTTGG - Intronic
975661621 4:76694581-76694603 CAGAGCTCAGATTCAAACGTAGG - Intronic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
977151215 4:93514549-93514571 GAGAGCTAGAATTCAAATGTGGG - Intronic
977449360 4:97175370-97175392 TGGAGCTCACATTCTAATGTTGG - Intergenic
978193125 4:105939146-105939168 CAAAGCTGACATGCTAATGGGGG + Intronic
978892705 4:113849075-113849097 CAGAGCTTACATTCTCCTATAGG - Intergenic
979181511 4:117734725-117734747 CAGTGCTCACAATCTATTGTAGG + Intergenic
979274957 4:118805117-118805139 CAGAGCTAACCTTATAGAGTGGG - Intronic
979714504 4:123820845-123820867 AAGAGCTACCATTCTATTGCAGG + Intergenic
980416254 4:132492533-132492555 CAGAGCTAAAATTCTAATCTAGG - Intergenic
980896094 4:138861985-138862007 CAGAGCTTACATTCTAATAAAGG + Intergenic
981742533 4:148017611-148017633 CACAGCTCTCATTATAATGTTGG - Intronic
981766267 4:148253806-148253828 TAGAGCTTACATTCTAGTGAGGG - Intronic
982021189 4:151206590-151206612 CATACCTAACATACTCATGTTGG - Intronic
982065490 4:151650974-151650996 CAGAGCATACATTCTACTGGGGG - Intronic
982244498 4:153337063-153337085 CAGAGCTGACATTCTGGGGTGGG + Exonic
984681404 4:182614110-182614132 CATAGTTTACATTGTAATGTTGG + Intronic
985167198 4:187109362-187109384 CAGAGCTTACATTCTCAGGGAGG + Intergenic
985181090 4:187264047-187264069 CAGAGCCAATTTTCTAATGGAGG - Intergenic
985519439 5:366136-366158 CACACCTAACATTCAGATGTTGG + Intronic
986850606 5:11808345-11808367 CAGAGCTGACAGTCTAGAGTGGG + Intronic
987762813 5:22187697-22187719 CAGAGCTTAGATTCTAGTCTGGG - Intronic
987764311 5:22205316-22205338 TAGAGCTCACATTCTAATAATGG + Intronic
989367625 5:40674541-40674563 CAGAGCAAAGATTTTAATCTAGG - Intergenic
989480075 5:41920500-41920522 CAGAGCTTATATTCTAGTGGAGG + Exonic
989552563 5:42752785-42752807 CACAGCTAACATTTTGATGGAGG + Intergenic
991557789 5:67914922-67914944 CAGAGCTAACATAGGAATGATGG - Intergenic
991897598 5:71421101-71421123 CAGAGCTTAGATTCTAGTCTGGG - Intergenic
991899045 5:71438446-71438468 TAGAGCTCACATTCTAATAATGG + Intergenic
993574534 5:89585513-89585535 AAGAGTTAACATAGTAATGTAGG + Intergenic
993916823 5:93754314-93754336 CAGAGCTTACATTCTAGTAAGGG - Intronic
994011182 5:94904910-94904932 TGGAGCTTACATTCTAATGAGGG + Intronic
994070735 5:95599072-95599094 CAGAGCTAACATTCTAATGTGGG - Intronic
994104014 5:95925472-95925494 CAGAGCTTATATTCTAGTGAAGG - Intronic
994158365 5:96528183-96528205 CAGAGCTAGTATTCAAATCTAGG + Intronic
994583201 5:101674144-101674166 CAGAGCTATCACTGCAATGTAGG + Intergenic
994998586 5:107098184-107098206 CAGAGCTCACATTCAAACCTAGG + Intergenic
995230184 5:109752487-109752509 TGGAGCTTACATTCTAATGGTGG + Intronic
995595109 5:113739262-113739284 CAGTGCTGACTTTCTAGTGTTGG + Intergenic
995848523 5:116520346-116520368 TAGAGCTTACATTCTAGTGGAGG - Intronic
997326434 5:133025876-133025898 GAGAGCTTACATTCTAGTGATGG - Intronic
997900173 5:137755993-137756015 AAAAGCTAACATTCTACTTTTGG - Intergenic
998602985 5:143604030-143604052 AAGAGTTTACATTCTAATGGAGG + Intergenic
998680057 5:144457271-144457293 AGGAGCTCACAGTCTAATGTAGG + Intronic
998754732 5:145364467-145364489 GGGAGCTTACATTCTAATGGAGG - Intergenic
998970369 5:147584661-147584683 AAGAGCTTACAGTCTCATGTGGG - Intergenic
998970400 5:147585031-147585053 CAGGGCTATCAGTGTAATGTAGG - Intergenic
999118281 5:149184315-149184337 CAGAGCAGCCATTCTAATGTTGG + Intronic
999945112 5:156587330-156587352 AAGAGCTAACAATCTGATCTGGG - Intronic
1000809438 5:165843031-165843053 CAGAACTTACAGTCTAGTGTGGG - Intergenic
1001849554 5:174951761-174951783 AAGAGCTTACATCCTAATGGGGG + Intergenic
1002900648 6:1407169-1407191 CAGACTTAACATTTTCATGTGGG - Intergenic
1003239158 6:4327629-4327651 CAGAGATTACATCCTAATGAGGG - Intergenic
1004474098 6:15955185-15955207 CAGAGCTAAGATTCTAATCCAGG + Intergenic
1005925564 6:30442431-30442453 CAGAGTGAACTTTCTAATGTTGG - Intergenic
1009293470 6:61913598-61913620 TTGAGCTTACATTCTAATGTGGG + Intronic
1011399147 6:86940736-86940758 CAAATCTAACGCTCTAATGTGGG + Intronic
1011567150 6:88688278-88688300 CAGAATTAACATTTTGATGTTGG + Intronic
1011586255 6:88928422-88928444 CAGAGCTCATATTCTAGTGTGGG - Intronic
1014193612 6:118526498-118526520 CAGAGCTAACATTCAAACCCAGG + Intronic
1014627809 6:123751067-123751089 CAGAGTTTACATTCTAGTGGGGG + Intergenic
1015105366 6:129530364-129530386 CTGAGCACACATTCTAAAGTTGG - Intergenic
1015303088 6:131676342-131676364 CAAAGATTACATTCTAATGCAGG - Intronic
1015589972 6:134813731-134813753 TAGAACTTACATTCTAATGAAGG + Intergenic
1017239150 6:152147761-152147783 CAGAGCTTCCACTCTAGTGTGGG - Intronic
1019762577 7:2824567-2824589 TAGAGCTTACATTCTAGTGTGGG - Intronic
1020467035 7:8492178-8492200 AAAATCTAAAATTCTAATGTCGG - Intronic
1021121418 7:16800137-16800159 CAGAGCTCACATACTTGTGTGGG + Intronic
1021663824 7:22952166-22952188 CAGAGCTCACACTGTAATATCGG + Intronic
1022652604 7:32290663-32290685 GAGAGCTAACATTCTAACAAGGG + Intronic
1022937964 7:35200007-35200029 CAGACCTAAAATTCTAAATTGGG - Intergenic
1024146339 7:46521428-46521450 CAGAGCTCATATTCTATTGGTGG + Intergenic
1024905050 7:54368221-54368243 TACAGCTAACAATCTAATGGAGG + Intergenic
1028700815 7:93777288-93777310 GGGAGCTCACATTCTAAAGTTGG + Intronic
1030819540 7:114079130-114079152 CAAACCTCACATTCTAATGAAGG - Intergenic
1032818137 7:135498127-135498149 CAGAGCCAACATTCATATGTAGG + Intronic
1033437872 7:141350380-141350402 CAGACCTTACATTCTAGTGGGGG - Intronic
1034074693 7:148220400-148220422 CATAGTTAACATTATGATGTTGG - Intronic
1034280229 7:149848536-149848558 CACTGCTAACATCATAATGTTGG + Intronic
1034364070 7:150530694-150530716 GAGATCTAACTTTTTAATGTGGG + Intergenic
1034486015 7:151363302-151363324 CATCTCTTACATTCTAATGTGGG - Intronic
1035836067 8:2753305-2753327 TAGTGTTATCATTCTAATGTAGG - Intergenic
1039164456 8:34661837-34661859 CAGAGCTAAATTTCAAGTGTGGG + Intergenic
1040911467 8:52523304-52523326 CAGAACGAAAATTCTAATTTTGG + Intergenic
1042318609 8:67451270-67451292 CAGAGCTCACCTAGTAATGTGGG - Intronic
1042937178 8:74071385-74071407 CAGAGTTAACTCTTTAATGTAGG + Intergenic
1042998831 8:74732533-74732555 CAGAGCTTACCTTTTATTGTAGG + Intronic
1043099285 8:76019742-76019764 AAGAGCTAACCATCTAATATTGG - Intergenic
1045243628 8:100423957-100423979 CAGAGCTTACATTTTAGTGGGGG + Intergenic
1046031699 8:108789735-108789757 CAGAGCTAAGGTTCTAACTTGGG + Intergenic
1046260812 8:111765606-111765628 CAAATATAACATTCTAATGCTGG + Intergenic
1046343655 8:112892846-112892868 TAGAGCTCGCATTCTAAGGTAGG - Intronic
1047978708 8:130157928-130157950 TAGAGCTGACATTCTAAGGAAGG - Intronic
1048487088 8:134858383-134858405 AAGAGCTAACAGTCAAATGAGGG - Intergenic
1048553496 8:135455228-135455250 CAGAACTTACATTCTATGGTAGG - Intergenic
1048974005 8:139661272-139661294 CAGAGCTTACATCCCAGTGTGGG + Intronic
1050068562 9:1786630-1786652 CAGAGTTTACATTCTAGTGGGGG - Intergenic
1050243506 9:3662113-3662135 CACAGCTAGCATTCAAATGCAGG - Intergenic
1050656419 9:7833421-7833443 TAGAGCTTACATTCTAGTGGAGG - Intronic
1050769882 9:9184677-9184699 CATAGTTTACAATCTAATGTGGG - Intronic
1050783109 9:9364333-9364355 AAGTGCTTACATTCTAATGGAGG + Intronic
1051042325 9:12826417-12826439 CAGACCTTTCATTCTAGTGTGGG - Intergenic
1051208615 9:14716987-14717009 TAGAGCTTACATTCTATTGGGGG - Intergenic
1051562876 9:18462423-18462445 TGGAGCTTACATTCTAATGAGGG + Intergenic
1051995288 9:23208583-23208605 CGGAGCTTACATTCTAATGCAGG + Intergenic
1053376396 9:37610123-37610145 TGGAGCTGACATTCTATTGTGGG - Intronic
1054931925 9:70644164-70644186 CAGAGCTTACATCCTACTGGTGG + Intronic
1055874898 9:80930540-80930562 AGGAGCTAAAATTCTAACGTAGG - Intergenic
1056054839 9:82810747-82810769 AAGAGCTAAAATTCTAATACTGG + Intergenic
1056925773 9:90833396-90833418 CAGAACTAAAACTCTAAGGTGGG + Intronic
1059057716 9:111001700-111001722 CTGTGCTAACAATCTAATGTAGG + Intronic
1059330348 9:113531347-113531369 CAGAGCCAAGATTCAAATCTAGG - Intronic
1059334066 9:113557646-113557668 CAGAGCTGACAGTCTAATGTGGG + Intronic
1059408978 9:114120102-114120124 CAGAGCCCACATTCTAACCTCGG - Intergenic
1059564871 9:115373916-115373938 TGGAGCTGACATTCTCATGTGGG + Intronic
1060677597 9:125529294-125529316 GAGAGCTAACATTCTAATAGAGG - Intronic
1060776987 9:126381979-126382001 CAGGGCTAACATTTTATTTTTGG + Intronic
1061206796 9:129168900-129168922 TAGAGCTTACATTCTAGTGGTGG - Intergenic
1061635504 9:131905947-131905969 CAGAGCTAACAGTCTAGTGAAGG + Intronic
1186558195 X:10583193-10583215 GAGAGCTTACATTTTAATGAAGG + Intronic
1187327532 X:18305547-18305569 TGGAGCTTACATTCTAATGCTGG + Intronic
1188581892 X:31723941-31723963 AAGAGCTCACAATCAAATGTGGG - Intronic
1190523800 X:51308072-51308094 CAGATCTAACTTTTTGATGTGGG + Intergenic
1191925172 X:66301304-66301326 CAGAACTTACATTCTAGTGGAGG - Intergenic
1192372256 X:70524197-70524219 AAGAGCTTACATTCTAGTGGGGG - Intergenic
1193559872 X:83005364-83005386 CAGAACTAACATTCTATTTCTGG + Intergenic
1193586161 X:83324115-83324137 CAGTGCCAAAATTCTAAGGTGGG + Intergenic
1194767870 X:97863560-97863582 GAGAGTTAACATTCCAATATGGG + Intergenic
1195679840 X:107536816-107536838 TGGAGCTGACATTCTAATGAGGG - Intronic
1196131607 X:112163209-112163231 CAGAGCCAACATTCAAATACAGG - Intergenic
1196172799 X:112608528-112608550 CGAAGCTTACATTCTAGTGTGGG - Intergenic
1196770450 X:119288294-119288316 CAGAGCTAGCATTCCAATCCAGG + Intergenic
1197181488 X:123541629-123541651 CAGAGCTTCCATTCTAGTGGAGG + Intergenic
1197329761 X:125139144-125139166 CAGAGCTTACAATCTGATGGGGG + Intergenic
1197503603 X:127273743-127273765 CAGAGCCAAAATCCTAATTTGGG - Intergenic
1197866601 X:131025695-131025717 CAGAGCTAATATTTTATTTTAGG + Intergenic
1198012545 X:132573134-132573156 CAGAGCTGAGATTCCAATCTAGG - Intergenic
1202140079 Y:21712510-21712532 TATAGCTAACTTTCTAATCTGGG + Intergenic