ID: 994070735

View in Genome Browser
Species Human (GRCh38)
Location 5:95599072-95599094
Sequence CAGAGCTAACATTCTAATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 8, 3: 47, 4: 341}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994070735 Original CRISPR CAGAGCTAACATTCTAATGT GGG (reversed) Intronic