ID: 994072771

View in Genome Browser
Species Human (GRCh38)
Location 5:95620614-95620636
Sequence CCGCGCGGCCACGGGGGACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994072762_994072771 -1 Left 994072762 5:95620592-95620614 CCTGGGAACTGCTGGGCGAGCCC 0: 1
1: 0
2: 0
3: 14
4: 178
Right 994072771 5:95620614-95620636 CCGCGCGGCCACGGGGGACCTGG 0: 1
1: 0
2: 2
3: 3
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994072771 Original CRISPR CCGCGCGGCCACGGGGGACC TGG Exonic
900109736 1:1000391-1000413 CCGCCCAGCCCCGGGGGTCCCGG - Intergenic
900138819 1:1130504-1130526 ACAGGCGGCCACGGTGGACCTGG - Intergenic
900269164 1:1778400-1778422 CCGGGCGGCCATGGGGCAACAGG - Intronic
900362068 1:2293911-2293933 CCGCGCCACCATGGGGGTCCAGG + Intronic
903349749 1:22710703-22710725 GCGCGCGGCCGCCGGGGGCCGGG + Intergenic
905626232 1:39491981-39492003 GCGCGCGGCCATGGCGGGCCGGG - Exonic
905734346 1:40315615-40315637 CCCGGCGGTCCCGGGGGACCCGG + Exonic
911078894 1:93909127-93909149 CCGCGCGGCCAAGGCGCTCCTGG - Exonic
924042603 1:239998050-239998072 CCCCGCGGCCACCGCCGACCCGG + Intergenic
1063498344 10:6530511-6530533 CTGCCCGGCAACGGGGGACTGGG + Intronic
1064764762 10:18659564-18659586 CCGCGCCGCGGTGGGGGACCCGG + Exonic
1071527719 10:86367552-86367574 CCTCGCGGCCACAGCGGAACAGG + Intergenic
1072555913 10:96513606-96513628 CCTCGCGGCGCCGGGGGACTCGG - Exonic
1072926378 10:99620447-99620469 CCGCGGGGCCAAGCGGGAGCCGG - Intronic
1073509564 10:104034707-104034729 CCTCGAGGCCCTGGGGGACCAGG + Exonic
1073509771 10:104035518-104035540 CCAGGGGGCCCCGGGGGACCAGG + Exonic
1074829934 10:117241174-117241196 TGGCGCGGGCACGGAGGACCCGG + Exonic
1076371750 10:129959810-129959832 CCGCGCGGGCTCGGGCGCCCTGG - Intronic
1076395795 10:130136622-130136644 CCCTTCGGCCTCGGGGGACCGGG + Intronic
1076554345 10:131311922-131311944 CCGGGCGGCCGCGGAGGACGTGG + Intergenic
1076904982 10:133357153-133357175 CCGCCCTGCCCTGGGGGACCTGG + Intronic
1077105951 11:842724-842746 CCGCGCGGGCCCGGGAGCCCCGG - Intergenic
1077463130 11:2720881-2720903 CCTCGAGGCCACTGGGGACTTGG + Intronic
1079056168 11:17208122-17208144 GCGCACGGGCCCGGGGGACCAGG + Intergenic
1080595891 11:33774235-33774257 CTGCGGAGCCACCGGGGACCGGG - Intronic
1082003657 11:47408427-47408449 CCTCGCGGCGGTGGGGGACCCGG - Intronic
1082821227 11:57545976-57545998 CTGCTCGGCCCCGGGGGCCCCGG + Exonic
1083274166 11:61587580-61587602 CTGCGCGGCCCTGGAGGACCAGG - Intergenic
1083571229 11:63763257-63763279 CCGGGCGGAGACGGGGGATCGGG - Exonic
1083921014 11:65781344-65781366 ACGCGCGGCCCCGGGGGGCGTGG + Intergenic
1084074443 11:66762219-66762241 CCGCGAGGCCGCAGGGGGCCCGG + Intronic
1084758113 11:71251878-71251900 CAGCGGGGTCTCGGGGGACCTGG + Intronic
1084888117 11:72223827-72223849 CCGCGCCGCCCCGGGGAGCCGGG - Intronic
1084973042 11:72781727-72781749 CCGCGCGGCCCCGGGTCTCCCGG - Intronic
1087170073 11:95041240-95041262 CTGGGCTGCCACGGGGAACCAGG - Intergenic
1092260658 12:6951804-6951826 CAGCACTGCCACGGGGAACCAGG - Intronic
1094680919 12:32666387-32666409 CGGCGGGGCGAGGGGGGACCAGG + Intergenic
1096994341 12:55829603-55829625 CCCCGCGGCCGCCGGCGACCTGG + Exonic
1104906392 12:132215678-132215700 CAGCCCGGCCTCGTGGGACCCGG - Intronic
1104936192 12:132365642-132365664 GCGCGTGGCCACGTGGCACCTGG - Intergenic
1104936279 12:132366055-132366077 GCGCGTGGCCACGTGGCACCTGG - Intergenic
1105031520 12:132887497-132887519 GCGGGCGGCGAAGGGGGACCTGG - Intronic
1105071303 12:133235777-133235799 GCGCGCGGGCAGGGGGGTCCGGG - Exonic
1105512131 13:21060615-21060637 CGGCGCGGCCGCGGGGAACGGGG + Intronic
1107849927 13:44561053-44561075 CCCCGGGGCGTCGGGGGACCAGG + Intronic
1115028169 14:28766564-28766586 CCGCGCGGCCTCGGGGTCCGAGG + Intergenic
1115852662 14:37599856-37599878 GCGCGCGGCCGCGGGGACCCAGG - Intronic
1115942637 14:38626925-38626947 CCCCACAGCCACTGGGGACCAGG - Intergenic
1117841991 14:59870244-59870266 CCGCGTCGCCACGGGCGACTGGG - Intronic
1119106847 14:71932684-71932706 CCGCGCGTCCTCGCGGGCCCGGG + Exonic
1122657663 14:103273294-103273316 GGGCGAGGCCGCGGGGGACCCGG - Intergenic
1122904456 14:104795455-104795477 CCGGGCGGCCACGGCGGGCGGGG + Intronic
1122942040 14:104985842-104985864 CGGCGGGGCCGCGCGGGACCAGG - Exonic
1123112552 14:105880096-105880118 CAGCGCCGTCAGGGGGGACCGGG + Intergenic
1125516414 15:40323682-40323704 CCGCGCGGCCACTGGAGACCAGG + Intergenic
1128161046 15:65422977-65422999 GGGCGCGGCCTCGGGGGCCCGGG + Exonic
1128768679 15:70266264-70266286 CCGTGAGGCCAAGGGGCACCAGG + Intergenic
1131171929 15:90184965-90184987 CGGCGCAGCCCCTGGGGACCCGG - Intronic
1131257467 15:90871779-90871801 CAGCCGGGCCCCGGGGGACCCGG - Intronic
1132522201 16:397084-397106 GCGCCGGGCCACGGGGGTCCGGG + Intronic
1132841293 16:1979569-1979591 CCGCGGGGCCACAGAGGACGAGG + Exonic
1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG + Intronic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1136399795 16:30011068-30011090 CGGCGCGGCGGCGGGGGACGGGG + Exonic
1136458501 16:30395631-30395653 CGGCGCGGGCAGGGGGCACCGGG + Intronic
1137617168 16:49855209-49855231 CCCCGCGTCCTCGGGCGACCAGG + Intronic
1138265475 16:55656849-55656871 ACGCGCAGCCCCGGGAGACCTGG + Exonic
1138651353 16:58463360-58463382 CCGCGCGGCCACAGGGGGCCTGG + Intronic
1141054909 16:80804942-80804964 CCGCGCAGCCCCGAGGGGCCAGG - Intergenic
1142150093 16:88508878-88508900 CCGCGGGGCCCCTGAGGACCTGG - Intronic
1144781188 17:17809518-17809540 CTGCGCAGCCAAGGGGGCCCAGG - Intronic
1145828165 17:27893065-27893087 CCGGGCGGCCTCGGAGGAGCAGG - Intronic
1148356494 17:46979010-46979032 CCGCGCGGCGCCGGGGGTCTCGG + Exonic
1150069701 17:62140297-62140319 CCCAGCGGCCACAGGGCACCGGG + Intergenic
1150108557 17:62479014-62479036 CCGGGCGGCCGCGGGGGGCGCGG - Exonic
1151906982 17:77055081-77055103 CCAGGCGGCCACGGGGGAGGTGG - Intergenic
1152519762 17:80848572-80848594 CTGTGTGGCCACGGGTGACCGGG + Intronic
1152552214 17:81035444-81035466 CGGCGCGGCCACCCGGGACCCGG + Intronic
1152710720 17:81869512-81869534 CCCTGCGGCCGCGGGGGTCCGGG - Intronic
1157338188 18:46756570-46756592 CCGCGCGCCCCCCGGGGCCCCGG - Exonic
1160499128 18:79393910-79393932 GCGCGCGGCCACCGTGGTCCCGG + Intergenic
1160728571 19:629995-630017 CCCAGCGGCCACAGGGCACCGGG + Exonic
1160732736 19:648621-648643 CCGGGCTGCCAGAGGGGACCTGG + Intronic
1160967626 19:1753567-1753589 GCGCGCAGCCACCGGGGAGCGGG + Exonic
1161013075 19:1969444-1969466 CCGCGGGGCCACTGAGGACACGG - Intronic
1162118213 19:8445080-8445102 CCGAGCGGCAACGGGGCTCCGGG + Exonic
1162572413 19:11480876-11480898 CTGCGCGGCCCCGCGGGGCCCGG + Exonic
1162597452 19:11640101-11640123 CCGCGCGGCAACTGCGGCCCAGG + Intergenic
1162612512 19:11767383-11767405 CTGCGCGGCCACTGCGGCCCTGG + Intronic
1162698484 19:12495756-12495778 CCGCGCGGCTACTGAGGCCCGGG + Intronic
1163843623 19:19626843-19626865 CCACGCGGCCACGGGGCAGGCGG + Exonic
1165419983 19:35717882-35717904 CAGCGCCGCCGCGGGAGACCGGG - Intergenic
1165871443 19:38975889-38975911 CCGCGAGGCCAGCGGGGAGCGGG + Exonic
1167134959 19:47610285-47610307 CCGCGGGGAGACGAGGGACCAGG + Intronic
1167300413 19:48674388-48674410 GGGGGCGGCCACGGGGGCCCGGG + Intergenic
1167331207 19:48857440-48857462 CCCCGCGGCCCCCTGGGACCCGG - Exonic
1168076291 19:53982442-53982464 CCCGGCGGCCCCGGGGGCCCGGG + Exonic
924962374 2:46296-46318 CCGCGCGGCGTCGGGGTCCCGGG + Exonic
926077129 2:9951038-9951060 GCGCGCGGCCGCGGTGGGCCAGG + Intergenic
930011518 2:46941399-46941421 CCGGGCGGCAGCGGGGGCCCGGG - Exonic
934501198 2:94861633-94861655 CCTCGCGGCCAGCGAGGACCTGG + Intergenic
934566971 2:95346583-95346605 CGGCGCGGCGGCGGGGGTCCCGG - Intronic
935225181 2:101046751-101046773 CCGCCAGGCCATGAGGGACCAGG + Intronic
936864790 2:117064991-117065013 CGGAGGGTCCACGGGGGACCAGG - Intergenic
940883256 2:158968340-158968362 AGGCGCAGCCCCGGGGGACCCGG + Intergenic
1169145333 20:3248620-3248642 CTGCGCGGCCAGCGGGGGCCCGG + Intergenic
1169558145 20:6770168-6770190 CCGCGCCGCCCAGGAGGACCTGG - Exonic
1170119431 20:12895576-12895598 CCCCGCTGCCACTGGGCACCTGG - Intergenic
1174607038 20:51768459-51768481 CCGCGCCGCCCCGGGGGAGGAGG + Exonic
1175924860 20:62466634-62466656 CCTTGCGGCCACGCAGGACCCGG + Intronic
1175997329 20:62817588-62817610 CCGGGCGGCCCTGGGGGGCCGGG - Exonic
1176034668 20:63030383-63030405 ACGCGCTCCCATGGGGGACCTGG + Intergenic
1180002426 21:45001417-45001439 CCACGTGGCCACGAGGGGCCAGG + Intergenic
1181057871 22:20268383-20268405 CCGCGCGGCGCCGGTGCACCGGG - Exonic
1182099942 22:27650742-27650764 CCGGCCTCCCACGGGGGACCAGG + Intergenic
1182586098 22:31345092-31345114 CGGCGCGGGCAGGGGGTACCAGG + Exonic
1182664129 22:31944902-31944924 CCTCCCGGCCATGGGCGACCCGG + Intronic
1183201214 22:36387132-36387154 CTGCCCGGACAAGGGGGACCCGG - Intronic
1184347922 22:43924477-43924499 CCGAGAGGACACAGGGGACCCGG - Intronic
1184759492 22:46536750-46536772 CCGCGCAGCCGCCGGGGACGGGG + Exonic
1185420193 22:50730761-50730783 CAGCGCAGCCCCGGGGGCCCGGG + Intergenic
954421217 3:50420008-50420030 CCGCGTCTCCGCGGGGGACCTGG - Intronic
954540749 3:51391687-51391709 CGGCAAGGCCTCGGGGGACCCGG + Exonic
956468558 3:69542275-69542297 CCGCGCGGGACCTGGGGACCCGG + Intronic
959849560 3:111071391-111071413 TCGCGGGTCCACGGGGGCCCCGG - Intronic
960586119 3:119322866-119322888 CGGCCCGGCCGCGGGGGTCCCGG + Intronic
961067001 3:123884206-123884228 CCGCGCGGCGAAGGCGGCCCGGG + Intronic
961305935 3:125959161-125959183 CCGTGAGGCCAGGAGGGACCTGG - Intergenic
961675220 3:128560864-128560886 CCCTGCTGCCACTGGGGACCAGG - Intergenic
961780798 3:129319114-129319136 CCACGGTGCCCCGGGGGACCTGG + Intergenic
964771241 3:160225963-160225985 CCGCGCGGCCAGGCGCGCCCGGG + Exonic
967859741 3:194141715-194141737 CCGCGCGGCCCCGCCGGGCCTGG + Intergenic
969344783 4:6563788-6563810 CCGGGCGGCTGCGGGGGGCCGGG + Intergenic
969447993 4:7256263-7256285 CAGGGCCGCCACGAGGGACCAGG + Intronic
976589322 4:86833388-86833410 CAGGGCGGCCACGGTGGAACAGG + Exonic
982157212 4:152535268-152535290 CGGCGGGGCCGGGGGGGACCCGG - Exonic
983649843 4:170026682-170026704 CCGCGCTGCCGCGGAGGCCCTGG - Intronic
984765721 4:183398925-183398947 GCCCGCGGCCGCGGCGGACCCGG - Intergenic
988578027 5:32444912-32444934 CCGCGCGGCCGCGGGGCGACGGG + Intergenic
989230014 5:39074574-39074596 CCGCCCGCCCACGCCGGACCCGG + Intergenic
994072771 5:95620614-95620636 CCGCGCGGCCACGGGGGACCTGG + Exonic
997266290 5:132496985-132497007 CGGCGCGGCCCCGCGGAACCCGG - Intergenic
1002368335 5:178730277-178730299 CCTCGCGGACTCGGGGCACCGGG - Intronic
1002691539 5:181053608-181053630 CAGGGCGGCCACCGGGGAACGGG + Intronic
1002771148 6:292022-292044 CCGCGCAGCCTCGGGTGTCCCGG + Intronic
1006298422 6:33180314-33180336 CTGCTCGGCCAGGGGGGCCCTGG + Exonic
1016969629 6:149750009-149750031 CCGGACGGCCCAGGGGGACCCGG - Intronic
1017738232 6:157381967-157381989 CCGCGCGGCCGGGGGGCTCCTGG + Exonic
1019501977 7:1369188-1369210 CCGCGCGGCTCCGAGCGACCAGG + Intergenic
1022493298 7:30837213-30837235 CCCCGTGGTCACAGGGGACCAGG + Intronic
1024317482 7:48035318-48035340 CAGCGATGCCACGGGGAACCGGG - Intergenic
1024963799 7:55004595-55004617 CCCCGCGGCCGCGGCGAACCTGG - Intergenic
1025615794 7:63114778-63114800 CCGCTCGGCCACGGCGGCCATGG + Intergenic
1029537222 7:101163795-101163817 CAGCGCGGCCTCGGGGGTCGGGG - Exonic
1032693859 7:134316629-134316651 CCGCCCCGCCCCGGGAGACCGGG + Intronic
1034222965 7:149460075-149460097 ACGCGCGGCCTCGGGGCCCCGGG - Intronic
1035265159 7:157686010-157686032 CCGCGCGGGGCCGCGGGACCTGG + Intronic
1046770513 8:118112208-118112230 CCGCGCGGCCCCGGGCGCCCTGG + Intergenic
1047423941 8:124728707-124728729 CCGCGCTGCGACGGGCGGCCGGG - Intergenic
1049177949 8:141205820-141205842 CCGGGCGGCCACCGGGGTGCGGG + Intergenic
1049789715 8:144467002-144467024 CCGCGCGGCCGCGGTGTCCCTGG + Exonic
1056992371 9:91423797-91423819 CCGCGCGGCCACGGCGCCCGCGG - Exonic
1057524195 9:95784607-95784629 CCGCTCGGCCACGTGGACCCTGG - Intergenic
1060355647 9:122905041-122905063 CCGCCCGACCGCCGGGGACCAGG + Intronic
1062357164 9:136170471-136170493 CCGCCCAGCGATGGGGGACCCGG + Intergenic
1062547546 9:137070434-137070456 CCGCTCGGCCATGGCGGCCCCGG + Exonic
1062621325 9:137423681-137423703 CAGCGCGGCCTCGGGGTCCCCGG - Exonic
1185456163 X:311838-311860 CCGTGCGGACACGGGGGAGATGG + Intronic
1190342416 X:49308336-49308358 CCCCACGGCCAGGGGAGACCTGG + Intronic
1200231115 X:154444382-154444404 GCGCGGGGCCGCCGGGGACCTGG - Intronic