ID: 994073217

View in Genome Browser
Species Human (GRCh38)
Location 5:95623654-95623676
Sequence TCATCTCAATGATGGCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994073212_994073217 30 Left 994073212 5:95623601-95623623 CCTTTGAAGAATTTAATCAGTTA No data
Right 994073217 5:95623654-95623676 TCATCTCAATGATGGCATGAAGG No data
994073214_994073217 -1 Left 994073214 5:95623632-95623654 CCCAATTTCAATTTTAGAAAGGT No data
Right 994073217 5:95623654-95623676 TCATCTCAATGATGGCATGAAGG No data
994073215_994073217 -2 Left 994073215 5:95623633-95623655 CCAATTTCAATTTTAGAAAGGTC No data
Right 994073217 5:95623654-95623676 TCATCTCAATGATGGCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994073217 Original CRISPR TCATCTCAATGATGGCATGA AGG Intergenic