ID: 994074850

View in Genome Browser
Species Human (GRCh38)
Location 5:95639285-95639307
Sequence GCATAGGCTTAGAATCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994074846_994074850 14 Left 994074846 5:95639248-95639270 CCAAATAAAGATGTACTTCTAGA No data
Right 994074850 5:95639285-95639307 GCATAGGCTTAGAATCTGAGAGG No data
994074845_994074850 27 Left 994074845 5:95639235-95639257 CCTGGAGCAATTGCCAAATAAAG No data
Right 994074850 5:95639285-95639307 GCATAGGCTTAGAATCTGAGAGG No data
994074844_994074850 28 Left 994074844 5:95639234-95639256 CCCTGGAGCAATTGCCAAATAAA No data
Right 994074850 5:95639285-95639307 GCATAGGCTTAGAATCTGAGAGG No data
994074848_994074850 -10 Left 994074848 5:95639272-95639294 CCCAAAAACTCTAGCATAGGCTT No data
Right 994074850 5:95639285-95639307 GCATAGGCTTAGAATCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994074850 Original CRISPR GCATAGGCTTAGAATCTGAG AGG Intergenic
No off target data available for this crispr