ID: 994075703

View in Genome Browser
Species Human (GRCh38)
Location 5:95646980-95647002
Sequence GCGGGCTTCCGCCCAGGCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994075693_994075703 24 Left 994075693 5:95646933-95646955 CCCTCTTGGGTTTTGGTTCAGCG 0: 1
1: 0
2: 1
3: 8
4: 88
Right 994075703 5:95646980-95647002 GCGGGCTTCCGCCCAGGCACAGG 0: 1
1: 0
2: 1
3: 11
4: 105
994075694_994075703 23 Left 994075694 5:95646934-95646956 CCTCTTGGGTTTTGGTTCAGCGT 0: 1
1: 0
2: 1
3: 4
4: 61
Right 994075703 5:95646980-95647002 GCGGGCTTCCGCCCAGGCACAGG 0: 1
1: 0
2: 1
3: 11
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994075703 Original CRISPR GCGGGCTTCCGCCCAGGCAC AGG Exonic