ID: 994079456

View in Genome Browser
Species Human (GRCh38)
Location 5:95690561-95690583
Sequence GGCTTTGCAATGGAAGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994079452_994079456 4 Left 994079452 5:95690534-95690556 CCTACTGGTCTTAGTTGTGATGA 0: 1
1: 0
2: 0
3: 12
4: 82
Right 994079456 5:95690561-95690583 GGCTTTGCAATGGAAGAATCAGG 0: 1
1: 0
2: 1
3: 14
4: 191
994079450_994079456 20 Left 994079450 5:95690518-95690540 CCAGCTTGAGCTGGTTCCTACTG 0: 1
1: 0
2: 0
3: 12
4: 143
Right 994079456 5:95690561-95690583 GGCTTTGCAATGGAAGAATCAGG 0: 1
1: 0
2: 1
3: 14
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994079456 Original CRISPR GGCTTTGCAATGGAAGAATC AGG Intronic
900546685 1:3233356-3233378 GGGTTTGCAATGGCAGAGTTTGG + Intronic
901644899 1:10711254-10711276 CACTTTTCAATGGAAGAAGCTGG - Intronic
905495563 1:38382882-38382904 GTAGTTGCAATGGAAAAATCAGG + Intergenic
905823890 1:41015081-41015103 GGCTTTGCTCTTGAAGAATTTGG + Intergenic
907689021 1:56644830-56644852 GGCTGTAAAAGGGAAGAATCGGG - Intronic
908163634 1:61436240-61436262 TCCTTTGCAAAGGAAGCATCTGG - Intronic
908310117 1:62872837-62872859 GGCATTGGAATGCAAGAATTAGG + Intergenic
912063642 1:105706781-105706803 GGCTTTGTAATGGAGGGATTAGG + Intergenic
915109074 1:153551521-153551543 GGCTTTTTAATGGAAGTATGGGG + Intergenic
917080770 1:171254992-171255014 GGGATTGCAAAGGAAGAATAAGG - Intronic
917119224 1:171631260-171631282 GGCTTTGGGATGGAAGAAGAGGG - Intergenic
920053864 1:203179215-203179237 GGCATCGCAATGTAAGACTCGGG - Exonic
924480560 1:244429233-244429255 GGCTTTGAAATGGAGGGATCTGG - Intronic
924505603 1:244680654-244680676 ATCTTTGCAATGGAAAAATATGG - Intronic
1063136931 10:3225564-3225586 TGCTTTGCAGTGGAAGAACAGGG - Intergenic
1064185310 10:13157193-13157215 GAGTTTGGAATGGAAGACTCAGG - Intergenic
1064235900 10:13574916-13574938 GGTTTTGTAATAGAAGAAACTGG - Intergenic
1064548543 10:16475461-16475483 CGAGTTGCAATGTAAGAATCTGG - Intronic
1068517027 10:58037618-58037640 GGCTTTGAAATGAAATATTCAGG - Intergenic
1070743324 10:78916845-78916867 GGTTTGTCAATGGTAGAATCAGG - Intergenic
1072755078 10:98014352-98014374 GGCTGTGCATTGGAATCATCTGG + Intronic
1075682273 10:124341491-124341513 GGGTGTGCAGTGGAAGAATGAGG - Intergenic
1076712062 10:132342327-132342349 GACCTTGTAATGGAAGTATCAGG + Intronic
1081296678 11:41398769-41398791 GGCTTTACCATGGTAGAATTAGG - Intronic
1087536905 11:99459478-99459500 GCCATTACAATGGAAGAGTCTGG + Intronic
1088171098 11:106997708-106997730 GGGTTTGCAATAGGAGAACCGGG + Intronic
1091311523 11:134578319-134578341 AGCTGTGCATTGGAAGAATGGGG + Intergenic
1092953862 12:13531682-13531704 GGCTTTGCAGGGGGAGAAGCTGG + Intergenic
1093006619 12:14058364-14058386 GACTTGACAATGGAAGATTCTGG + Intergenic
1093271964 12:17074416-17074438 GGCTTAGCATTGGAAGAGACAGG - Intergenic
1094189972 12:27688034-27688056 GGCGTTGCAGTGGTATAATCAGG - Intronic
1095700338 12:45184961-45184983 GGCTTTTCAAAGGGAGAATGAGG - Intergenic
1097283380 12:57859737-57859759 GGGTTTCCAAGGGAAGAATCAGG + Intergenic
1098485467 12:71016425-71016447 GGCTTTGGAATGGAAAAAACGGG - Intergenic
1098919038 12:76286096-76286118 AGCTTTGAGATGGAAGAGTCGGG + Intergenic
1099075175 12:78097561-78097583 TGTTTTAAAATGGAAGAATCTGG + Intronic
1099657210 12:85508774-85508796 GGTTTTGGCAGGGAAGAATCAGG + Intergenic
1099870701 12:88345784-88345806 GGCCTTGGAATGTAAGAAGCTGG - Intergenic
1101452214 12:104790060-104790082 GACTTTGAAGTGGAAGACTCGGG - Intergenic
1105246872 13:18660647-18660669 GATTTTGCAGTGGAAGAATGGGG + Intergenic
1106100810 13:26694222-26694244 GGGTTGGCATTGGAAGCATCAGG - Intergenic
1110549321 13:76794210-76794232 GGGTTTGGAAAGCAAGAATCAGG + Intergenic
1110993420 13:82072641-82072663 CCCACTGCAATGGAAGAATCAGG + Intergenic
1112665322 13:101565127-101565149 TGCTTTGTTATGGAAGATTCAGG + Intronic
1115355624 14:32443523-32443545 GGCTATGCAATGGAATCACCTGG - Intronic
1115375999 14:32676169-32676191 GGCTTTGCAGTGGAAGTAAAGGG + Intronic
1115400315 14:32951486-32951508 GACTTTGCAATGGAAGCAATAGG + Intronic
1117906218 14:60591265-60591287 GGCTTTTTACTGTAAGAATCTGG + Intergenic
1118206761 14:63729697-63729719 GGAATTGCAATGGCACAATCAGG - Intergenic
1118470140 14:66067770-66067792 GGCCTGGGAATGGAAGACTCAGG + Intergenic
1118779888 14:69000703-69000725 AGGTTTTCAATGGAAGAAACAGG - Intergenic
1121824807 14:97001399-97001421 AGCTTTGCCATGGAAGTGTCAGG - Intergenic
1122879642 14:104684585-104684607 GGCTATGCAATGGAACTTTCTGG + Intergenic
1123725289 15:23095515-23095537 GGCTTTGCTAAGGAAGACCCAGG + Intergenic
1123889616 15:24763792-24763814 GGCTTTTTAAAGGAAGAATGAGG + Intergenic
1131293416 15:91126997-91127019 GGCTTTGGAATGAAAGAACTTGG + Intronic
1131674274 15:94655204-94655226 GGATTTTCTATGGAAGAGTCAGG + Intergenic
1133400082 16:5479400-5479422 GGCTTTGCAAAGGAAGCCTTTGG - Intergenic
1133845329 16:9448192-9448214 GACCTTGCGATGAAAGAATCTGG + Intergenic
1135534936 16:23286419-23286441 GACTTCACAATGGAAGGATCTGG + Intronic
1137012781 16:35340093-35340115 GGCTCTGGAATGAAAGTATCTGG - Intergenic
1137365558 16:47856422-47856444 ACCTTTGCCATGTAAGAATCTGG + Intergenic
1138102895 16:54268716-54268738 CACTTTGCAATGGAAGAATCAGG - Intronic
1139293810 16:65882074-65882096 GGCTTTTCAATGGATGATTGTGG + Intergenic
1141609399 16:85172550-85172572 GGCTTTGCAAGGGACCAAGCAGG + Intronic
1143369765 17:6431757-6431779 AGCTTTGGAATGGATGGATCAGG + Intronic
1145304113 17:21662812-21662834 GACTTTGCAGTGGAGAAATCTGG + Intergenic
1148168878 17:45503094-45503116 GGCTTTGCAAAAGAAGAAGGCGG - Intergenic
1148279937 17:46339918-46339940 GGCTTTGCAAAAGAAGAAGGTGG + Intronic
1148302155 17:46557774-46557796 GGCTTTGCAAAAGAAGAAGGTGG + Intronic
1150400074 17:64849554-64849576 GGCTTTGCAAAAGAAGAAGGCGG - Intergenic
1151278078 17:73050942-73050964 GGCTTGTCAATGGAAGAATAAGG + Intronic
1151290946 17:73149387-73149409 GGGTTTGAGAGGGAAGAATCTGG - Intergenic
1153483233 18:5568702-5568724 GGCTCTGGAATGGAGGAAGCAGG + Intronic
1154441982 18:14398473-14398495 GATTTTGCAATGGAAGAATGGGG - Intergenic
1157884822 18:51356902-51356924 GGCTTTATAATAGAAGAAGCTGG + Intergenic
1158223729 18:55178687-55178709 GCCTTTTCAATGGAAAAATCAGG + Intergenic
1158716551 18:59885472-59885494 GGGTTTCCAATGGCAGAATTAGG + Intergenic
1160129830 18:76214892-76214914 GGATTTGCTATTGAAGAATCTGG + Intergenic
1162648373 19:12066229-12066251 GGTTTTTCAAAGGCAGAATCGGG + Intronic
1163784513 19:19267846-19267868 GGCTTTGTCATGGAACACTCAGG + Intronic
1164877667 19:31702981-31703003 GACTTAGCAATGGAAGGCTCAGG + Intergenic
1165070331 19:33251719-33251741 CACTTTGCAGAGGAAGAATCCGG - Intergenic
1165480937 19:36063761-36063783 GGCTTTGAAGTGGAGGAATCTGG - Intronic
1165936057 19:39389743-39389765 GGCTTTGTACTGGACGAACCTGG + Exonic
1167663645 19:50811062-50811084 GGCTATGCAAAGGCAGAAGCTGG + Intergenic
1167734292 19:51282467-51282489 TGCTGTGCAGAGGAAGAATCAGG - Intergenic
1167765112 19:51477463-51477485 GGGTTTTCAATGGAAAAATGAGG + Intergenic
925770110 2:7273977-7273999 GGCTTTACAATGGAGAAACCTGG + Intergenic
926287257 2:11499201-11499223 GTCTTTTCAATGGCTGAATCTGG + Intergenic
926597458 2:14806838-14806860 GGTGATGCAATGGAATAATCAGG - Intergenic
926857587 2:17273508-17273530 GAGTGTGCAATGGAAGAATTGGG + Intergenic
926879771 2:17531770-17531792 AGCTTTGCATTGGAAGAAACTGG + Intergenic
927394801 2:22637492-22637514 GGCTCTGCCAAGGAAGAAGCTGG - Intergenic
927420082 2:22921560-22921582 AACTTTTCAATGGAAAAATCTGG + Intergenic
927551953 2:24009182-24009204 GGCCTCCCAAGGGAAGAATCAGG - Intergenic
930630760 2:53752496-53752518 GCCTGTGCACTGGAAGAATGGGG - Intronic
932360537 2:71102013-71102035 TGCTATGCACTGGAAGAACCTGG - Intergenic
935444209 2:103139355-103139377 GGCATTACTATGAAAGAATCTGG - Intergenic
935985581 2:108669777-108669799 GGCTTTCCACTAGAAGACTCAGG - Intronic
936138009 2:109913405-109913427 GGCTTTCCACTAGAAGACTCAGG - Intergenic
936206688 2:110458080-110458102 GGCTTTCCACTAGAAGACTCAGG + Intronic
939102220 2:137907964-137907986 GATTTTGCAATGGAATAATGGGG + Intergenic
940849041 2:158671074-158671096 ATCTCTGCAATGGAAGAGTCAGG - Intronic
942735770 2:179111079-179111101 GGCTGTGAAATGTAGGAATCAGG + Intronic
944684791 2:202108767-202108789 GTCTTTACAATGGAAAAATGGGG - Intronic
946613486 2:221483840-221483862 TGCTTTCAAGTGGAAGAATCAGG + Intronic
947093960 2:226545118-226545140 GGGTTTAAAATGGAAGGATCAGG + Intergenic
948147149 2:235716381-235716403 GGCTTTGAAATGGAAGTTGCGGG + Intronic
948371587 2:237493045-237493067 GGCTTTGCAATGGAAAACCCTGG - Intronic
948590976 2:239049961-239049983 GCCTTTGCAAAGGAAGAAAAAGG + Exonic
948707643 2:239804986-239805008 GGTTTTAAAATGAAAGAATCAGG + Intergenic
1169289733 20:4338818-4338840 GTCTTTGCTATGGATGAAGCTGG - Intergenic
1169556245 20:6753411-6753433 GGCCTTGCTTTGGAAGAAGCAGG - Intergenic
1170677106 20:18492606-18492628 GCCTTTCCAATGGAGAAATCAGG - Intronic
1171267642 20:23785134-23785156 AGCTTGTAAATGGAAGAATCAGG + Intergenic
1172641050 20:36440710-36440732 GGGTTTGCAAAGGGAGAACCAGG + Intronic
1173877449 20:46383246-46383268 GGCTTTGCTAAGGAAGACCCAGG - Intronic
1174017563 20:47501359-47501381 TGCTTTACAATGGAAAGATCTGG - Intergenic
1174844121 20:53927075-53927097 AGCCTTCCAATGGAAGAAACGGG - Intergenic
1176454089 21:6892698-6892720 GATTTTGCAGTGGAAGAATGGGG + Intergenic
1176832263 21:13757746-13757768 GATTTTGCAGTGGAAGAATGGGG + Intergenic
1179064226 21:38009043-38009065 GGCTTCCCAATGGAACAATAAGG - Intronic
1184060891 22:42080434-42080456 GGGTTTTCAAATGAAGAATCGGG + Intronic
949104251 3:184293-184315 GGCTCTGCAAATAAAGAATCAGG - Intergenic
949869148 3:8572364-8572386 GACTTTACAATGGAAAAATCTGG - Intergenic
950775401 3:15345575-15345597 GGCTTTCCAATGGAAAACTGAGG + Intergenic
951550942 3:23874517-23874539 AGCATTGCAACTGAAGAATCTGG + Intronic
954743392 3:52772517-52772539 GGCATTCCAAAGGAAGAATAAGG + Intergenic
955104418 3:55883246-55883268 ATCTTTACATTGGAAGAATCAGG + Intronic
955996456 3:64685240-64685262 TGCCTTTCAATGGAAGGATCGGG - Intronic
959237094 3:103738275-103738297 GGGTTTTTAAGGGAAGAATCAGG + Intergenic
960934352 3:122888311-122888333 GGCTTTCTAATGGTAGAATTTGG + Intergenic
963022899 3:140889226-140889248 GACTTTATAATGGAAGGATCAGG + Intergenic
963357046 3:144221625-144221647 GGCTTTGAAATGGAAATATCTGG + Intergenic
964001309 3:151776059-151776081 GGCTTTGAAATCAGAGAATCAGG + Intergenic
964056569 3:152467745-152467767 GGATGTGTAATCGAAGAATCAGG - Intergenic
964511883 3:157461505-157461527 GGCTTTGCATTGTATTAATCAGG - Intronic
965038215 3:163470313-163470335 GACTTTGAAATAGAGGAATCTGG + Intergenic
965691449 3:171361144-171361166 GGCTGTGCATTGCAAGCATCTGG + Intronic
965888487 3:173478969-173478991 GGCATTTCAATGTAATAATCAGG + Intronic
966154800 3:176903908-176903930 GGCTTGGAAATAGAAGGATCTGG - Intergenic
966386156 3:179400810-179400832 AGTTTTGTAATGGAAGAACCAGG - Exonic
966517415 3:180833159-180833181 GGTTTGGCAATGGAATAATATGG - Intronic
971058461 4:22940089-22940111 GGATTTGCACTGGAATCATCTGG - Intergenic
971594440 4:28510599-28510621 TGGTTTGCAATGGCAGATTCTGG + Intergenic
978277295 4:106967554-106967576 GCCTTTGCCCTGGAAGAAACAGG + Intronic
978297336 4:107221224-107221246 TGCTTTGCAGCTGAAGAATCTGG + Intronic
980683681 4:136198036-136198058 GGCTTTGCAATGGACAATTTTGG + Intergenic
981441334 4:144786118-144786140 GGCTGTGAAAGGGAAGAAGCAGG + Intergenic
981682553 4:147416296-147416318 GGCTTTACACTGGAAAAAACTGG + Intergenic
981763833 4:148224654-148224676 GGCTTTGAAGTGGAACAATACGG + Intronic
982044560 4:151430395-151430417 TGCTTTTCAATGAAAGAATGTGG - Intronic
984274630 4:177595339-177595361 GGCTGCGCAATGGAAGGATATGG - Intergenic
986519664 5:8600881-8600903 TGCTTTGCAATGGAATTATGAGG - Intergenic
990105935 5:52261648-52261670 GGGTTTGCTATGGAAAAATAAGG - Intergenic
993966400 5:94365560-94365582 GGCTTTGCAAAGGCAGTTTCAGG - Intronic
994079456 5:95690561-95690583 GGCTTTGCAATGGAAGAATCAGG + Intronic
1000070018 5:157731683-157731705 GGACTTGCAAGGGAAGAAGCTGG - Intronic
1001037189 5:168305635-168305657 AGCTCTGCAATGGACGAATAAGG + Intronic
1002900694 6:1407507-1407529 GGCTTTGCAGAGGACGAATAGGG - Intergenic
1005911351 6:30312525-30312547 GACATTTCAGTGGAAGAATCAGG - Intergenic
1006595906 6:35192403-35192425 GTGTTTGCAATGGAAAAGTCAGG + Intergenic
1009690369 6:67023961-67023983 GAATTTGCACTGGGAGAATCAGG + Intergenic
1010792202 6:80077695-80077717 CCCTGTGCAATGGAAGAATCAGG - Intergenic
1012005501 6:93708217-93708239 GCATTTCCAATGGAAGAAACTGG - Intergenic
1012639961 6:101597739-101597761 TGCTTTGAAATGGAAGAAAAGGG - Intronic
1013659081 6:112276237-112276259 GGCCTTGCAGTGGAAGATTTAGG + Intergenic
1017407719 6:154138172-154138194 GACTTTGCAGTGGCAGAAACAGG - Intronic
1017444242 6:154492988-154493010 GGCTTTGCAAGGGTGGGATCAGG - Intronic
1017572509 6:155762105-155762127 GGCTGTGGGATGGAAGAATGAGG - Intergenic
1017656791 6:156637178-156637200 GGATTTGGAAAGGAAGAAGCTGG + Intergenic
1018284340 6:162220831-162220853 GGATTTGCAGTGAAAGAAACAGG + Intronic
1020008716 7:4796627-4796649 GGTTTTGCAGTGGGAGAAGCTGG + Intergenic
1020114993 7:5471258-5471280 GGGTTTGCACTGGAAGCCTCGGG - Intronic
1022095472 7:27138642-27138664 GGTTTTGCCATTGAAGAATATGG + Intronic
1023335834 7:39168908-39168930 TGCTTTGAAATGGATCAATCTGG - Intronic
1024371700 7:48592154-48592176 ACCTTTGCAATTGAAGAAACTGG - Intronic
1026651990 7:72223667-72223689 GGCTTTTCAATAGAACAATTGGG - Intronic
1028409497 7:90513123-90513145 AGCTTTTCAAGGGATGAATCAGG + Intronic
1028917272 7:96273005-96273027 GCCTTTACAATGGAAATATCAGG + Intronic
1029421867 7:100476138-100476160 GGGTTTGCTTTGGAAGAGTCTGG + Intronic
1030061289 7:105623335-105623357 GGCTCTGCAATGGCAGCACCAGG + Intronic
1031402318 7:121340033-121340055 GCCTTTTCACTGGGAGAATCTGG + Exonic
1035682870 8:1501356-1501378 GTCTTTGCAGAGGAAGAAGCTGG + Exonic
1040939710 8:52819615-52819637 GGCTTTGCTTGGGAAGAAGCAGG + Intergenic
1043609599 8:82045877-82045899 GGCTTTGGAGTGGAACAAACAGG - Intergenic
1045706862 8:104934111-104934133 GGCTTTGGAAAGGAAGAAAGAGG - Intronic
1048783341 8:138024658-138024680 GGCTTTGAAATGGAAGAGGAAGG - Intergenic
1049942842 9:565092-565114 GGATTTGCAAAGGAAGAAAAGGG - Intronic
1050971299 9:11879072-11879094 TGTTTTGTAATGGAAGGATCTGG + Intergenic
1056448918 9:86695778-86695800 GGCCATGCCATGGAAGAAACTGG - Intergenic
1057044934 9:91878372-91878394 GGCTTTGCAGAAGAAGAGTCTGG - Intronic
1059576255 9:115491976-115491998 GCTTTTCCAATGGAAAAATCAGG - Intergenic
1060169014 9:121445294-121445316 GGCTTTGAAAAGGAAAAAGCAGG - Intergenic
1062008016 9:134251315-134251337 GGCTTAGCAATTAAAGAACCAGG + Intergenic
1062039807 9:134399123-134399145 GGCTTGGTAAAGGAAGAAGCTGG + Intronic
1187078419 X:15959981-15960003 GACTTTGCAGTGGAGAAATCTGG + Intergenic
1187224840 X:17365408-17365430 GGCTGTGCAATGAAAGAGTAGGG + Intergenic
1187899019 X:24010121-24010143 GGGTTTGCAATGGAATAAGTGGG - Intronic
1189450853 X:41129009-41129031 GAATTTTCATTGGAAGAATCAGG - Exonic
1189608669 X:42707543-42707565 AACTTTGCAATGAAAAAATCTGG - Intergenic
1193331353 X:80238615-80238637 TGCGTTGCAAGGGAAGAATCAGG - Intergenic
1197665547 X:129219495-129219517 GGAGTTGCAATTGAAGAGTCTGG + Intergenic
1198711856 X:139512877-139512899 TCCTTTTCAATGGAAGAATGGGG - Intergenic
1199973026 X:152874562-152874584 GGTTTTGTGATGGAAGAATGAGG + Intergenic
1202087167 Y:21150493-21150515 GACTTTACAATGGTAGTATCTGG + Intergenic