ID: 994080045

View in Genome Browser
Species Human (GRCh38)
Location 5:95698461-95698483
Sequence GGAACCTTCTACTGCATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994080045_994080054 28 Left 994080045 5:95698461-95698483 CCAGAAATGCAGTAGAAGGTTCC 0: 1
1: 0
2: 0
3: 7
4: 109
Right 994080054 5:95698512-95698534 CGGGTTATTTGCCACTCCTAAGG 0: 1
1: 0
2: 0
3: 1
4: 24
994080045_994080051 9 Left 994080045 5:95698461-95698483 CCAGAAATGCAGTAGAAGGTTCC 0: 1
1: 0
2: 0
3: 7
4: 109
Right 994080051 5:95698493-95698515 TCCAAGAGACAAATAACCTCGGG 0: 1
1: 0
2: 0
3: 11
4: 184
994080045_994080055 29 Left 994080045 5:95698461-95698483 CCAGAAATGCAGTAGAAGGTTCC 0: 1
1: 0
2: 0
3: 7
4: 109
Right 994080055 5:95698513-95698535 GGGTTATTTGCCACTCCTAAGGG No data
994080045_994080050 8 Left 994080045 5:95698461-95698483 CCAGAAATGCAGTAGAAGGTTCC 0: 1
1: 0
2: 0
3: 7
4: 109
Right 994080050 5:95698492-95698514 TTCCAAGAGACAAATAACCTCGG 0: 1
1: 0
2: 0
3: 25
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994080045 Original CRISPR GGAACCTTCTACTGCATTTC TGG (reversed) Intronic