ID: 994080048 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:95698482-95698504 |
| Sequence | TTGTCTCTTGGAAGCCTTCC GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 272 | |||
| Summary | {0: 1, 1: 0, 2: 5, 3: 33, 4: 233} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 994080048_994080055 | 8 | Left | 994080048 | 5:95698482-95698504 | CCCGGAAGGCTTCCAAGAGACAA | 0: 1 1: 0 2: 5 3: 33 4: 233 |
||
| Right | 994080055 | 5:95698513-95698535 | GGGTTATTTGCCACTCCTAAGGG | No data | ||||
| 994080048_994080054 | 7 | Left | 994080048 | 5:95698482-95698504 | CCCGGAAGGCTTCCAAGAGACAA | 0: 1 1: 0 2: 5 3: 33 4: 233 |
||
| Right | 994080054 | 5:95698512-95698534 | CGGGTTATTTGCCACTCCTAAGG | 0: 1 1: 0 2: 0 3: 1 4: 24 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 994080048 | Original CRISPR | TTGTCTCTTGGAAGCCTTCC GGG (reversed) | Intronic | ||