ID: 994080048

View in Genome Browser
Species Human (GRCh38)
Location 5:95698482-95698504
Sequence TTGTCTCTTGGAAGCCTTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 233}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994080048_994080055 8 Left 994080048 5:95698482-95698504 CCCGGAAGGCTTCCAAGAGACAA 0: 1
1: 0
2: 5
3: 33
4: 233
Right 994080055 5:95698513-95698535 GGGTTATTTGCCACTCCTAAGGG No data
994080048_994080054 7 Left 994080048 5:95698482-95698504 CCCGGAAGGCTTCCAAGAGACAA 0: 1
1: 0
2: 5
3: 33
4: 233
Right 994080054 5:95698512-95698534 CGGGTTATTTGCCACTCCTAAGG 0: 1
1: 0
2: 0
3: 1
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994080048 Original CRISPR TTGTCTCTTGGAAGCCTTCC GGG (reversed) Intronic