ID: 994080049

View in Genome Browser
Species Human (GRCh38)
Location 5:95698483-95698505
Sequence TTTGTCTCTTGGAAGCCTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994080049_994080054 6 Left 994080049 5:95698483-95698505 CCGGAAGGCTTCCAAGAGACAAA 0: 1
1: 0
2: 2
3: 14
4: 214
Right 994080054 5:95698512-95698534 CGGGTTATTTGCCACTCCTAAGG 0: 1
1: 0
2: 0
3: 1
4: 24
994080049_994080055 7 Left 994080049 5:95698483-95698505 CCGGAAGGCTTCCAAGAGACAAA 0: 1
1: 0
2: 2
3: 14
4: 214
Right 994080055 5:95698513-95698535 GGGTTATTTGCCACTCCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994080049 Original CRISPR TTTGTCTCTTGGAAGCCTTC CGG (reversed) Intronic