ID: 994080050 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:95698492-95698514 |
Sequence | TTCCAAGAGACAAATAACCT CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 238 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 25, 4: 212} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
994080045_994080050 | 8 | Left | 994080045 | 5:95698461-95698483 | CCAGAAATGCAGTAGAAGGTTCC | 0: 1 1: 0 2: 0 3: 7 4: 109 |
||
Right | 994080050 | 5:95698492-95698514 | TTCCAAGAGACAAATAACCTCGG | 0: 1 1: 0 2: 0 3: 25 4: 212 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
994080050 | Original CRISPR | TTCCAAGAGACAAATAACCT CGG | Intronic | ||