ID: 994080050

View in Genome Browser
Species Human (GRCh38)
Location 5:95698492-95698514
Sequence TTCCAAGAGACAAATAACCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994080045_994080050 8 Left 994080045 5:95698461-95698483 CCAGAAATGCAGTAGAAGGTTCC 0: 1
1: 0
2: 0
3: 7
4: 109
Right 994080050 5:95698492-95698514 TTCCAAGAGACAAATAACCTCGG 0: 1
1: 0
2: 0
3: 25
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994080050 Original CRISPR TTCCAAGAGACAAATAACCT CGG Intronic