ID: 994080051

View in Genome Browser
Species Human (GRCh38)
Location 5:95698493-95698515
Sequence TCCAAGAGACAAATAACCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994080045_994080051 9 Left 994080045 5:95698461-95698483 CCAGAAATGCAGTAGAAGGTTCC 0: 1
1: 0
2: 0
3: 7
4: 109
Right 994080051 5:95698493-95698515 TCCAAGAGACAAATAACCTCGGG 0: 1
1: 0
2: 0
3: 11
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994080051 Original CRISPR TCCAAGAGACAAATAACCTC GGG Intronic