ID: 994080051 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:95698493-95698515 |
| Sequence | TCCAAGAGACAAATAACCTC GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 196 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 11, 4: 184} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 994080045_994080051 | 9 | Left | 994080045 | 5:95698461-95698483 | CCAGAAATGCAGTAGAAGGTTCC | 0: 1 1: 0 2: 0 3: 7 4: 109 |
||
| Right | 994080051 | 5:95698493-95698515 | TCCAAGAGACAAATAACCTCGGG | 0: 1 1: 0 2: 0 3: 11 4: 184 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 994080051 | Original CRISPR | TCCAAGAGACAAATAACCTC GGG | Intronic | ||