ID: 994080052

View in Genome Browser
Species Human (GRCh38)
Location 5:95698494-95698516
Sequence ACCCGAGGTTATTTGTCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994080052_994080055 -4 Left 994080052 5:95698494-95698516 CCAAGAGACAAATAACCTCGGGT No data
Right 994080055 5:95698513-95698535 GGGTTATTTGCCACTCCTAAGGG No data
994080052_994080054 -5 Left 994080052 5:95698494-95698516 CCAAGAGACAAATAACCTCGGGT No data
Right 994080054 5:95698512-95698534 CGGGTTATTTGCCACTCCTAAGG 0: 1
1: 0
2: 0
3: 1
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994080052 Original CRISPR ACCCGAGGTTATTTGTCTCT TGG (reversed) Intronic