ID: 994080055

View in Genome Browser
Species Human (GRCh38)
Location 5:95698513-95698535
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994080048_994080055 8 Left 994080048 5:95698482-95698504 CCCGGAAGGCTTCCAAGAGACAA 0: 1
1: 0
2: 5
3: 33
4: 233
Right 994080055 5:95698513-95698535 GGGTTATTTGCCACTCCTAAGGG No data
994080052_994080055 -4 Left 994080052 5:95698494-95698516 CCAAGAGACAAATAACCTCGGGT No data
Right 994080055 5:95698513-95698535 GGGTTATTTGCCACTCCTAAGGG No data
994080045_994080055 29 Left 994080045 5:95698461-95698483 CCAGAAATGCAGTAGAAGGTTCC 0: 1
1: 0
2: 0
3: 7
4: 109
Right 994080055 5:95698513-95698535 GGGTTATTTGCCACTCCTAAGGG No data
994080049_994080055 7 Left 994080049 5:95698483-95698505 CCGGAAGGCTTCCAAGAGACAAA 0: 1
1: 0
2: 2
3: 14
4: 214
Right 994080055 5:95698513-95698535 GGGTTATTTGCCACTCCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type