ID: 994080730

View in Genome Browser
Species Human (GRCh38)
Location 5:95706385-95706407
Sequence CAGGAGGAAGGGAGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994080730_994080742 -3 Left 994080730 5:95706385-95706407 CCCCCTTCCCTCCCTTCCTCCTG No data
Right 994080742 5:95706405-95706427 CTGCTCCAGCCACAAATGGGTGG No data
994080730_994080739 -7 Left 994080730 5:95706385-95706407 CCCCCTTCCCTCCCTTCCTCCTG No data
Right 994080739 5:95706401-95706423 CCTCCTGCTCCAGCCACAAATGG No data
994080730_994080740 -6 Left 994080730 5:95706385-95706407 CCCCCTTCCCTCCCTTCCTCCTG No data
Right 994080740 5:95706402-95706424 CTCCTGCTCCAGCCACAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994080730 Original CRISPR CAGGAGGAAGGGAGGGAAGG GGG (reversed) Intergenic
No off target data available for this crispr