ID: 994081613

View in Genome Browser
Species Human (GRCh38)
Location 5:95713458-95713480
Sequence CAGGAGGAAGGGAGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994081613_994081622 -7 Left 994081613 5:95713458-95713480 CCCCCTTCCCTCCCTTCCTCCTG No data
Right 994081622 5:95713474-95713496 CCTCCTGCTCCAGCCACAAATGG No data
994081613_994081623 -6 Left 994081613 5:95713458-95713480 CCCCCTTCCCTCCCTTCCTCCTG No data
Right 994081623 5:95713475-95713497 CTCCTGCTCCAGCCACAAATGGG No data
994081613_994081625 -3 Left 994081613 5:95713458-95713480 CCCCCTTCCCTCCCTTCCTCCTG No data
Right 994081625 5:95713478-95713500 CTGCTCCAGCCACAAATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994081613 Original CRISPR CAGGAGGAAGGGAGGGAAGG GGG (reversed) Intergenic
No off target data available for this crispr