ID: 994082144

View in Genome Browser
Species Human (GRCh38)
Location 5:95718867-95718889
Sequence GGTCCCAGGAGAGCACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 243}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994082144 Original CRISPR GGTCCCAGGAGAGCACAAGC AGG Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900204669 1:1426868-1426890 GGGCGCAGGAGGGCAGAAGCGGG + Intronic
901230061 1:7636783-7636805 GGTCTAGGGAGGGCACAAGCAGG + Intronic
901232109 1:7647090-7647112 GGTCCCTGGAGAGCAGGTGCTGG - Intronic
901971662 1:12913452-12913474 AGTCCCAGGAGAGGAAGAGCGGG - Intronic
902013505 1:13288288-13288310 AGTCCCAGGAGAGGAAGAGCGGG + Intergenic
902511202 1:16967879-16967901 GGTCCCAGGGTACCACAACCTGG - Intronic
903379362 1:22886098-22886120 GGTCCCAGGAGGGCACCAATAGG + Intronic
905256953 1:36690989-36691011 GGGCCCAGGACAGCACCATCAGG - Intergenic
907844915 1:58196295-58196317 GGTCCCAGGAGGAAACAGGCTGG + Intronic
916809566 1:168293479-168293501 GGCACCAGGAGAGCACATGCTGG - Intronic
919372855 1:196752137-196752159 GGTCCAATGAAAGCAAAAGCAGG - Intergenic
919379299 1:196836819-196836841 GGTCCGATGAAAGCAAAAGCAGG - Intronic
919773850 1:201180803-201180825 AGCCCCAGGAGAGAACCAGCAGG + Intergenic
919794285 1:201311865-201311887 TTTCCCAGGAGCTCACAAGCTGG - Intronic
919919708 1:202160735-202160757 GGCCCCAGAAGGGCACAGGCGGG - Exonic
919924617 1:202185941-202185963 TGTCCCAGGAGTGCACAACCTGG - Intergenic
920218480 1:204378086-204378108 GGAGCCCGGAGAGCAGAAGCTGG + Intergenic
920316366 1:205078202-205078224 GGTCCAAGCAGAGCACAGGCAGG + Exonic
920347391 1:205315113-205315135 GGTCCCAGGAGATCACAGTACGG + Intronic
922740964 1:228014032-228014054 GGTCCCAGGAGGCGACCAGCTGG + Intronic
922949858 1:229549608-229549630 GGTTCCAGGTGAGAACAAGCAGG + Intronic
922955673 1:229597360-229597382 GATCCCTGGGGAGCACCAGCTGG - Intronic
923281098 1:232443611-232443633 GGACCCTGGAGACCACAAGTGGG - Exonic
923361777 1:233218954-233218976 GGAGCCAGGAGAGCTCCAGCAGG + Intronic
923934401 1:238745597-238745619 GGTCCAAGGAAAGCCCAGGCAGG + Intergenic
924371866 1:243359566-243359588 TGTACCTGGAGGGCACAAGCGGG + Intronic
924710692 1:246527910-246527932 GGTCTCAGCAGATCACAAGATGG + Intergenic
1062901108 10:1147693-1147715 TGGCTCAGGAGAGCACCAGCGGG - Intergenic
1064158707 10:12925132-12925154 GGTTCCAGGAGAGCCCAACTGGG + Intronic
1067296535 10:44978000-44978022 GGGCCACGGAGAGCAGAAGCCGG + Exonic
1067546585 10:47196496-47196518 GCTCCCAGGACAGCAGAGGCAGG - Intergenic
1070546769 10:77458640-77458662 GATCCCAGGGGAGAACCAGCTGG + Intronic
1070646337 10:78204665-78204687 GTTCCCAGGAGAGAAGGAGCTGG - Intergenic
1073288878 10:102403574-102403596 GGTCCCAGGAGAGCCCAGAGGGG - Intronic
1075093363 10:119455757-119455779 GGCCCCAGGAGAGGACATTCTGG - Intronic
1075522986 10:123155004-123155026 TGTCCCAGGAGGAGACAAGCAGG - Exonic
1076573052 10:131445006-131445028 GGTGCCAGCAAAGCACAGGCTGG + Intergenic
1076892285 10:133291171-133291193 GGTCTCAGGAAAGCACACCCCGG - Intronic
1077093823 11:791045-791067 GGACTCAGGAGAGACCAAGCTGG + Exonic
1078068410 11:8093020-8093042 GGTCCCAAGTGAGCACAAATGGG + Intronic
1078795722 11:14590704-14590726 GATCCCAGGGGAGCACAGACTGG - Intronic
1080408273 11:31999563-31999585 TGGGCCAGGAGAGCACAAGAAGG - Intronic
1083243940 11:61411048-61411070 GGTCCCGGGAGAGCAGCAGGAGG - Exonic
1083751889 11:64765598-64765620 GGCGCCAGGAGAGCCCAAGCTGG + Intronic
1085889066 11:80556305-80556327 GCCCCAAGGAGAGCACAAACTGG + Intergenic
1089095823 11:115919294-115919316 GGTCCCAGGAAGGCACAGGAAGG + Intergenic
1090840092 11:130479800-130479822 GGTGCCATGAGAGCTCAAGATGG - Intergenic
1092527067 12:9315809-9315831 GGTCCCAGGACAGCAGGTGCTGG - Intergenic
1092540202 12:9415963-9415985 GGTCCCAGGACAGCAGGTGCTGG + Intergenic
1093756379 12:22857467-22857489 TATGCCAGGAGTGCACAAGCTGG + Intergenic
1093866509 12:24233813-24233835 GATCCCAGGAGAGAACAAGCTGG + Intergenic
1094512840 12:31106493-31106515 GGTCCCAGGACAGCAGGTGCCGG - Intergenic
1096239423 12:49951714-49951736 GGTCCCCGGAGCCCATAAGCTGG + Intronic
1096384602 12:51186755-51186777 GGTGGCAGGAGGGCCCAAGCAGG + Intergenic
1101836432 12:108298900-108298922 GGTCCCAGGAGGGCTCCAGAAGG + Intronic
1102890187 12:116552765-116552787 GCCCCCAGGAGAGCCCAGGCTGG + Intergenic
1103512890 12:121487470-121487492 GGTCCCAGGAGAGCAAAGAAAGG - Intronic
1103779784 12:123390467-123390489 TGTCTCAGGAGAGCACTGGCAGG - Intronic
1104282456 12:127390450-127390472 GGTCCCAGCTGAGCTCAAGCTGG + Intergenic
1104340236 12:127942685-127942707 GGTCCCATGACAGCACACTCTGG + Intergenic
1104558543 12:129823605-129823627 GGGCCCAGGGAAGCAAAAGCAGG + Intronic
1106177914 13:27347075-27347097 CCTCCCAGGACAGCACAAGCTGG - Intergenic
1106920038 13:34553380-34553402 AGTCCCAGGAGAGGACTACCAGG + Intergenic
1107359887 13:39606925-39606947 GGTGAAAGGAGAGCAGAAGCAGG - Intergenic
1108492294 13:50993655-50993677 ATTCCCAGGAGGGCACAGGCAGG - Intergenic
1108684802 13:52809485-52809507 GGCCCCAGGTGACCACAAGGTGG - Intergenic
1114623474 14:24113785-24113807 GGCCCCAGGAGGGCCCAAGAAGG + Intronic
1118321698 14:64757215-64757237 AATCCCAGGAGAGCAGAGGCTGG - Intronic
1120392203 14:83923759-83923781 GCTCCCAGGAGATCCCAACCAGG - Intergenic
1123044578 14:105505122-105505144 GGCCCCAGGACTGCACCAGCAGG + Intergenic
1123410647 15:20056227-20056249 GGGCTCAGGACATCACAAGCGGG - Intergenic
1123450605 15:20357225-20357247 GCCCCCAGGAGAGCACACGCAGG - Intergenic
1123519977 15:21062933-21062955 GGGCTCAGGACATCACAAGCGGG - Intergenic
1127857679 15:62966194-62966216 GTGCCCAGGATAGCACAAGCTGG - Intergenic
1128914793 15:71549950-71549972 GGTCCAAGGACAGAACAACCTGG + Intronic
1130638275 15:85646040-85646062 GGAAACAGGAGAGCACAAGAGGG - Intronic
1130651800 15:85766331-85766353 GGGCCCAGGACAGCATGAGCCGG + Intronic
1132600218 16:769767-769789 GGTCCCAGGAGAGCAGCCGCAGG - Intronic
1132790023 16:1680649-1680671 GGTCTCAGGAGAGGAAAACCTGG - Intronic
1132813670 16:1815574-1815596 GGTCACAGCAGAGCAACAGCTGG + Intronic
1133293934 16:4740820-4740842 GGTCCCAGCAGAGCACATCCTGG + Intronic
1133344737 16:5062336-5062358 TGCCCCAGGAGAGCCCACGCTGG + Intronic
1136253725 16:29024488-29024510 GGACCCAGGAGGGGCCAAGCGGG + Intergenic
1136269028 16:29137705-29137727 GGTCCCCTGAGAGCACAGCCAGG + Intergenic
1138544479 16:57707495-57707517 GGACCCAGGAGTGCACCCGCAGG - Exonic
1141378022 16:83549503-83549525 GGACCCTCGAGGGCACAAGCAGG - Intronic
1142072334 16:88098072-88098094 GGTCCCCTGAGAGCACAGCCAGG + Intronic
1143323054 17:6080525-6080547 GACCCCAGGCGAGCACAGGCAGG + Exonic
1144770257 17:17755663-17755685 GGGCCCAGGATAGGATAAGCAGG - Intronic
1144965570 17:19075386-19075408 GGCCCAAGGAGAGCACATGAGGG + Intergenic
1144982397 17:19176797-19176819 GGCCCAAGGAGAGCACATGAGGG - Intergenic
1144985826 17:19201442-19201464 GGCCCAAGGAGAGCACATGAGGG + Intergenic
1145877638 17:28331683-28331705 GGACACATGAGAGCACAAGAGGG + Intronic
1146459323 17:33033302-33033324 GCTCCCAGAAGAGCACAGGGAGG - Intronic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1147561398 17:41511512-41511534 CATCCCAGGAGAGCAGAAACAGG + Intergenic
1147596968 17:41723800-41723822 GGTACCAGGACAGCACTAGAGGG + Exonic
1149073545 17:52572588-52572610 GGTCAAAGGAGAGAACAAACAGG + Intergenic
1151489838 17:74426449-74426471 GATCCCAGGAGAGCAGAGGGAGG + Intronic
1151549944 17:74816589-74816611 GGACCCAGGAGAGTACAAATGGG - Intronic
1151701232 17:75743641-75743663 GGTCACAGGAGAGCAGGAGGTGG + Intronic
1152337834 17:79708109-79708131 GCCCCCAGGAGAGCACCCGCAGG + Intergenic
1152458129 17:80427693-80427715 GGTCCTGGGAGAGCACAGACGGG + Intronic
1152534060 17:80940495-80940517 GATCCCAGAAGAGCACGACCTGG + Exonic
1160945928 19:1644101-1644123 GGTCCTCGGAGAGGAGAAGCAGG + Intronic
1161551665 19:4916427-4916449 GGTCTCAGGAGGGCACAGGGAGG - Intronic
1162057695 19:8074507-8074529 GGTCTCAGGAGAGAGCAAGTGGG + Intronic
1162789376 19:13055174-13055196 GGGCCCAGGAGGGCACAGACAGG - Intronic
1163002722 19:14378793-14378815 GATTCCAGGTGAGCACAACCAGG - Intergenic
1163764158 19:19153122-19153144 GGTCCCACGAGAGCAGCAGCAGG + Intronic
1164527452 19:29022515-29022537 GGGCCCAGGTGAGCACATGGTGG + Intergenic
1164619056 19:29682918-29682940 GGTCCCTGGAGCACACCAGCAGG + Intergenic
1165610689 19:37149737-37149759 GATCTCAGGAGACCACAAGCTGG - Exonic
1166871357 19:45872866-45872888 GCTCCCAGGGGAGCTGAAGCTGG + Exonic
1166916109 19:46196954-46196976 GCTCCCAGGAGATCCCAGGCTGG + Intergenic
1167307026 19:48715231-48715253 GGTCCCGGGAGAACAGAAGTGGG + Intronic
1167475903 19:49700874-49700896 GGTCCCAGGAGAGCCTGAGCAGG - Intronic
1167533115 19:50031299-50031321 GTTCCCAGAAGAGTACAAACAGG - Intronic
1168281246 19:55306519-55306541 GGGCCCAGGAGTGCAGCAGCAGG + Intronic
1168454321 19:56494187-56494209 GATCGCAGGAGAGCACAGACTGG + Intergenic
925366248 2:3314036-3314058 GCTCCCCGGAGAGCACCACCCGG + Intronic
925559114 2:5168827-5168849 GGTCCCAGTGTAGCAGAAGCAGG + Intergenic
926211503 2:10874183-10874205 GGTGCCAGGAGGGCACAGGAAGG - Intergenic
927178084 2:20424407-20424429 GCTCCCATGAGAGCACAAGGCGG - Intergenic
927807605 2:26161857-26161879 GGTGCCAGGCGAGAAGAAGCTGG - Intergenic
929951184 2:46410682-46410704 AGCCCCATGAGAGCAGAAGCAGG - Intergenic
930197387 2:48523067-48523089 GATTACAGGAGTGCACAAGCAGG - Intergenic
930834899 2:55782953-55782975 GAACCCAGGAGAGCATGAGCTGG + Intergenic
931868773 2:66438200-66438222 GGTCCCAGATGAGAAGAAGCTGG + Intronic
935186930 2:100743106-100743128 TTTCCCAGGAAAGCACAGGCTGG - Intergenic
935337797 2:102033479-102033501 GCTTTCAGGAGTGCACAAGCTGG - Intergenic
936105866 2:109623876-109623898 GGACCCAGGAGAGCCCAGGATGG + Intergenic
936660478 2:114537513-114537535 GGTCCCTGGTGTGCACAAGGAGG + Intronic
936772782 2:115935116-115935138 GGTCCCAGAAGAAAGCAAGCAGG - Intergenic
937554575 2:123137804-123137826 TGTCCCAGAAGAGCAAAAACTGG + Intergenic
940289913 2:152068396-152068418 GGTCCCGGCACAGCCCAAGCAGG + Intronic
946231230 2:218292334-218292356 GGGCCCAGGAGCGGGCAAGCCGG + Intronic
946302348 2:218831708-218831730 GGTCCCAGGGGAGCCGGAGCCGG - Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
947145390 2:227059482-227059504 GGTCCCAGGTGACCAAATGCAGG + Exonic
947586853 2:231361796-231361818 GGCCCCCGGAGAGGACAGGCAGG + Intronic
947794091 2:232883518-232883540 GGTCCCAGGAGAGCCCCACTTGG + Intronic
948025663 2:234774147-234774169 GGTCCCAGCAGAGCAGCAGGTGG - Intergenic
948369496 2:237479382-237479404 GGTCCCAGTATAGCCCAAGTGGG - Intergenic
948375103 2:237516064-237516086 GGTCACAGGTGTGAACAAGCAGG - Intronic
948650514 2:239440618-239440640 GCTCCCAGGCGAGCCCGAGCTGG - Intergenic
948779637 2:240310746-240310768 GTTCCCAGGAGAGCACCAGATGG - Intergenic
1169368347 20:5009385-5009407 GGTTCCAGGAGAGGCCAAGGTGG - Intronic
1171283854 20:23922167-23922189 TGTCCCAGCAGACCACAACCTGG - Intergenic
1172780963 20:37436898-37436920 ATTCCCAGGAGTGGACAAGCAGG - Intergenic
1172786034 20:37469509-37469531 GGTCCCAGGAGAACAGGAGAAGG - Intergenic
1172991988 20:39043263-39043285 GACCCCAGGAGAGCAGGAGCTGG + Intergenic
1173053413 20:39587766-39587788 GGTCTCTGGAGAGCCCTAGCTGG - Intergenic
1173304906 20:41838903-41838925 TGTCCCATCAGAGCACAAGGAGG - Intergenic
1175382036 20:58570047-58570069 GGTCCCAGGGGTGCCCAAGTGGG - Intergenic
1178906587 21:36642036-36642058 GGCCCCAGGAGTCCACAGGCAGG - Intergenic
1180069257 21:45427937-45427959 TCTCCCAGGACAGAACAAGCAGG - Intronic
1181464388 22:23102919-23102941 GGCCCCAGCAGAGCCCACGCTGG - Intronic
1182253804 22:29023502-29023524 GCTCCCAGGAGTGGAGAAGCAGG + Intronic
1184425334 22:44405938-44405960 GGTCCCAGGGGGGCACAGGGAGG - Intergenic
1184976248 22:48064445-48064467 GGACCCAGAGCAGCACAAGCTGG + Intergenic
1185173002 22:49304380-49304402 GCTCCCAGCAAAGCACAGGCTGG + Intergenic
1185318533 22:50189703-50189725 GGTCCCAGCAGAGCATCACCTGG - Intronic
1185318549 22:50189761-50189783 GGTCCCAGCAGAGCATCACCTGG - Intronic
1185318565 22:50189819-50189841 GGTCCCAGCAGAGCATCACCTGG - Intronic
949537892 3:5009985-5010007 GGTCCAGGGAGAGCAGAACCAGG + Intergenic
949879338 3:8649325-8649347 GGTCCCAGGAGCGGGCAAGGTGG + Intronic
950874271 3:16255952-16255974 AGTGCCAGGAGAGCCCAGGCTGG - Intergenic
950882670 3:16335872-16335894 GGTCTCAGGAGGCCACAGGCAGG + Intronic
954426363 3:50445297-50445319 GGTCCCAGGAGAGCCCAGCTAGG + Intronic
955508794 3:59658712-59658734 GGTACCAGTAGACCACCAGCTGG - Intergenic
956923075 3:73951416-73951438 GTTCCCAGGAGGGCAGCAGCAGG - Intergenic
961932532 3:130548665-130548687 GTTCCCAGTAGAGCACCAGGAGG + Intergenic
962092805 3:132262867-132262889 GGCCCCAGGAGAGCAGTAACAGG - Intronic
963758374 3:149259426-149259448 GGTCCCTGGACAGCACATGTGGG - Intergenic
964492876 3:157255617-157255639 GGACAAAGGAGAGCACAGGCAGG + Intergenic
967191161 3:186985909-186985931 GGTCCCAGGGGAGGCTAAGCTGG + Intronic
967749834 3:193101295-193101317 AGTCCCAAGACAGCACAAGGCGG - Intergenic
967766106 3:193281199-193281221 AGTCCCAGGAACGCAGAAGCTGG + Intronic
969873994 4:10122641-10122663 GGTCCCGGGAAAGGACAGGCCGG - Intergenic
979591764 4:122489224-122489246 GTTCCCAGACAAGCACAAGCTGG - Intergenic
984727762 4:183037723-183037745 GGACCCAGGGGAGCCAAAGCCGG - Intergenic
985524561 5:395367-395389 AGTCCCGGGAGAGGACAAGGTGG + Intronic
985629126 5:1005640-1005662 GGGCCCAGGAGAGGACACGCCGG + Intergenic
985775449 5:1839137-1839159 GATCCCAGGAGAACAGAAGAGGG - Intergenic
985822080 5:2167201-2167223 GGCCCAAGGAGAGCCCCAGCTGG + Intergenic
985848102 5:2368802-2368824 GCAACCAGGAGATCACAAGCAGG - Intergenic
986881190 5:12173609-12173631 GGTAGCAGGAGAGCACAAAGAGG - Intergenic
993068910 5:83134003-83134025 GGTTCCAGGTGAGCACGGGCTGG + Intronic
993376177 5:87151257-87151279 AGTTCCAGGAGAGCACAGACAGG - Intergenic
993648319 5:90486576-90486598 GGTTCCAGCAGAGAACCAGCAGG - Intronic
994082144 5:95718867-95718889 GGTCCCAGGAGAGCACAAGCAGG + Intronic
996881422 5:128300890-128300912 GGTACCAGGAGAGCAAGAGCCGG + Exonic
997639172 5:135437370-135437392 GGTCCCTGGAGGGCAGAAGCTGG + Intergenic
997657798 5:135568278-135568300 GGTCCCAGGACAACAGAGGCTGG - Intergenic
998159042 5:139802875-139802897 AATCCCAGCAGAGCACATGCAGG + Intronic
999427676 5:151501475-151501497 GGTCCCAGGAGGGACCAGGCTGG + Intergenic
999928592 5:156406402-156406424 GGGCACAGGAGAGCAGAAGTAGG - Intronic
1001255058 5:170177050-170177072 GGTCCCAGGACAGCTCAAACAGG + Intergenic
1001268115 5:170289913-170289935 CGTCTCAGCAGAGCAGAAGCTGG - Intronic
1001559372 5:172659300-172659322 AGCCCCAGGAGAGCACCTGCGGG - Intronic
1002096812 5:176836200-176836222 GGGCCCAGGAGGGCAACAGCAGG + Intronic
1004306500 6:14506197-14506219 TATCCCAGGTGAGGACAAGCTGG + Intergenic
1006815101 6:36844782-36844804 GGGCACAGAAGAGCAGAAGCGGG + Intergenic
1007078901 6:39085067-39085089 GGTCCCTGGAGAGGCCTAGCTGG - Intronic
1007180831 6:39927951-39927973 GGTCCTTGGAGAGTACAACCTGG + Intronic
1007429517 6:41768643-41768665 GGGCCCAGCAGAGCTCAAGAGGG - Intergenic
1007585443 6:42986266-42986288 AGCCCCAGGAGAGGAGAAGCTGG - Intronic
1011642673 6:89430730-89430752 GGTCTCATGAGAGCCAAAGCAGG - Intergenic
1012691479 6:102318753-102318775 GGTCCCAGAAGAACAAAAGCTGG - Intergenic
1015458366 6:133457135-133457157 GGCTGCAGGAGAGCACATGCTGG + Intronic
1017037959 6:150284070-150284092 GGGCACAGGACAGCACAAGATGG - Intergenic
1020261128 7:6531287-6531309 GGTCCCAGCAGGGCAGAGGCGGG - Intronic
1021117466 7:16760093-16760115 GGACCCAGGAGAGCACTATAGGG + Intronic
1021746304 7:23744861-23744883 GTTTCCAGGACAGCACATGCTGG + Intronic
1023876637 7:44289719-44289741 GCTCCCAGGACAGCATAGGCAGG + Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1024596186 7:50939742-50939764 AGTCCCAGGAGAGTCCAAGGAGG + Intergenic
1026391989 7:69911583-69911605 GCTCCCAGGAGACCTCAAGTGGG + Intronic
1026908533 7:74078667-74078689 GGTCCCATAAGCGCAGAAGCAGG + Intergenic
1027056594 7:75053697-75053719 GGGCCCAGGAGTGCCCCAGCTGG - Intronic
1027374821 7:77538267-77538289 GGCCTCAGGAGAGGAGAAGCGGG - Intronic
1027926776 7:84475100-84475122 GGTCCCAGGAGTGCAGGGGCTGG + Intronic
1029464505 7:100716764-100716786 GGTCCTGGGAGAGCAGAGGCTGG + Intergenic
1030547411 7:110914095-110914117 GGTCCAGGAAGAGCAAAAGCAGG - Intronic
1031075498 7:117208519-117208541 GGAGCCAGGAGAACACATGCAGG - Intronic
1031129316 7:117813209-117813231 GGTCCCAGCAGTGCAAAAGGGGG - Intronic
1031754371 7:125619082-125619104 GATCCCAGGAGACCAAAAGATGG - Intergenic
1032441216 7:131944542-131944564 GGTCCTTGGACAGCACCAGCCGG - Intergenic
1034331484 7:150287007-150287029 GGTCCCAGCATGCCACAAGCCGG + Intronic
1034666559 7:152822854-152822876 GGTCCCAGCACGCCACAAGCCGG - Intronic
1035068501 7:156124565-156124587 GGACTCAGGACAGCACAAGGAGG - Intergenic
1035398273 7:158549099-158549121 CATCCAAGGCGAGCACAAGCGGG + Intronic
1035760452 8:2064787-2064809 GGTGCCAGGAGAGGAGAAGGAGG - Intronic
1040872432 8:52114317-52114339 GCTTCAAGGAGAGCACATGCTGG + Intronic
1041135135 8:54749940-54749962 GGGCCCAGGAGAGAGGAAGCAGG + Intergenic
1045949517 8:107835810-107835832 GCTGCCAGGAGAGCACTTGCAGG - Intergenic
1046677271 8:117124038-117124060 TGTCCCAGGAGAGGCAAAGCTGG + Intronic
1047542843 8:125787111-125787133 GGTCCCAAGAAAGCAAAAGCAGG - Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1048786110 8:138052243-138052265 GGTTCAAGGAGAGAACAAGGTGG - Intergenic
1048907881 8:139105768-139105790 GGCCCTAGGAGAGCAGAATCTGG - Intergenic
1048974106 8:139661672-139661694 GGTCCCAGGAGAGGCCAACAGGG + Intronic
1049382837 8:142325921-142325943 GGGCCCCGGAGAGCACGAGACGG + Intronic
1049382895 8:142326165-142326187 GGGCCCCGGAGAGCACGAGACGG + Intronic
1049437817 8:142595769-142595791 GGTCCCTGGAGGGCCCATGCAGG - Intergenic
1049621247 8:143599280-143599302 GGTCCCAGGAGAGGCCAGCCAGG - Exonic
1049767046 8:144359705-144359727 GGCCCCAGGAAAGGACGAGCAGG + Exonic
1052352679 9:27473402-27473424 GCTCACAGGAGGGCACAGGCAGG + Intronic
1052852791 9:33387934-33387956 GGCCGCAGGAGAGAACACGCTGG + Intronic
1055368441 9:75571512-75571534 GGTCCTATGACAGCACATGCTGG + Intergenic
1056811484 9:89768475-89768497 GGTCCAATCAGAGCAAAAGCAGG + Intergenic
1057229917 9:93315040-93315062 GGTCCCATCAGAGCAAAAGTGGG - Intronic
1057802272 9:98197773-98197795 GCTCCCAGGAGGGCTAAAGCAGG - Intergenic
1060176281 9:121499603-121499625 GGTCCCCGGAGGCCACGAGCAGG - Intergenic
1061720635 9:132548953-132548975 GGGCCCAGGAGACCCGAAGCAGG - Intronic
1062052275 9:134453802-134453824 GGCCCCAGGTGAGCACTGGCCGG + Intergenic
1062518368 9:136947151-136947173 GGTCCCAGCAGGGCACAAGATGG - Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1185891458 X:3825636-3825658 GGCACCAGGAGAGCCCAGGCTGG + Intronic
1185896564 X:3864050-3864072 GGCACCAGGAGAGCCCAGGCTGG + Intergenic
1185901682 X:3902476-3902498 GGCACCAGGAGAGCCCAGGCTGG + Intergenic
1187191399 X:17038672-17038694 AGTCCCAGCACTGCACAAGCTGG - Intronic
1187737939 X:22323470-22323492 GGTGCCAAGAGAGCAAAAGAAGG - Intergenic
1190719293 X:53133937-53133959 AGTTCCAGGAGAGGATAAGCTGG - Intergenic
1191841251 X:65514899-65514921 GGACCCAGCAGAGCTCATGCTGG - Exonic
1192179791 X:68909288-68909310 GTTCCCAGGAGGGAACATGCTGG + Intergenic
1192562361 X:72135523-72135545 TTTCCCAGCAGAGCACAGGCTGG - Intronic