ID: 994083203

View in Genome Browser
Species Human (GRCh38)
Location 5:95731144-95731166
Sequence CACAAAGGAGCCGCCCGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 62}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994083203_994083217 17 Left 994083203 5:95731144-95731166 CCCGCGCGGGCGGCTCCTTTGTG 0: 1
1: 0
2: 1
3: 6
4: 62
Right 994083217 5:95731184-95731206 GAGCTCCCGGGGCCTCCGCGGGG 0: 1
1: 0
2: 1
3: 12
4: 189
994083203_994083216 16 Left 994083203 5:95731144-95731166 CCCGCGCGGGCGGCTCCTTTGTG 0: 1
1: 0
2: 1
3: 6
4: 62
Right 994083216 5:95731183-95731205 GGAGCTCCCGGGGCCTCCGCGGG 0: 1
1: 0
2: 1
3: 31
4: 237
994083203_994083211 6 Left 994083203 5:95731144-95731166 CCCGCGCGGGCGGCTCCTTTGTG 0: 1
1: 0
2: 1
3: 6
4: 62
Right 994083211 5:95731173-95731195 CGCCGCCACCGGAGCTCCCGGGG 0: 1
1: 1
2: 1
3: 11
4: 123
994083203_994083208 4 Left 994083203 5:95731144-95731166 CCCGCGCGGGCGGCTCCTTTGTG 0: 1
1: 0
2: 1
3: 6
4: 62
Right 994083208 5:95731171-95731193 GCCGCCGCCACCGGAGCTCCCGG 0: 1
1: 0
2: 2
3: 45
4: 387
994083203_994083215 15 Left 994083203 5:95731144-95731166 CCCGCGCGGGCGGCTCCTTTGTG 0: 1
1: 0
2: 1
3: 6
4: 62
Right 994083215 5:95731182-95731204 CGGAGCTCCCGGGGCCTCCGCGG 0: 1
1: 0
2: 2
3: 25
4: 200
994083203_994083206 -5 Left 994083203 5:95731144-95731166 CCCGCGCGGGCGGCTCCTTTGTG 0: 1
1: 0
2: 1
3: 6
4: 62
Right 994083206 5:95731162-95731184 TTGTGTCCAGCCGCCGCCACCGG 0: 1
1: 0
2: 0
3: 9
4: 90
994083203_994083210 5 Left 994083203 5:95731144-95731166 CCCGCGCGGGCGGCTCCTTTGTG 0: 1
1: 0
2: 1
3: 6
4: 62
Right 994083210 5:95731172-95731194 CCGCCGCCACCGGAGCTCCCGGG 0: 1
1: 3
2: 2
3: 22
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994083203 Original CRISPR CACAAAGGAGCCGCCCGCGC GGG (reversed) Intronic
900240800 1:1616323-1616345 CGCGCAGGAGCCGCCAGCGCCGG - Intronic
902076704 1:13792787-13792809 CAGAAAGGTGCCCCACGCGCTGG - Intronic
902208577 1:14888135-14888157 CACAATAGAGCTGCCCGGGCTGG - Intronic
902691098 1:18110477-18110499 CAGAGAGGAGCAACCCGCGCCGG + Intronic
905553001 1:38859253-38859275 CGCACAGGCGCGGCCCGCGCGGG - Intronic
909475203 1:76074592-76074614 CACTGAGGAGCCGCCGGCGCCGG + Intergenic
915367198 1:155323096-155323118 CGCGAAGGAGCCGGGCGCGCAGG + Exonic
1066180774 10:32958480-32958502 GACAAAGGAACCGGCTGCGCGGG + Intronic
1067830854 10:49610393-49610415 CGCTAAGAGGCCGCCCGCGCTGG - Exonic
1068693136 10:59938771-59938793 CACAAGTGAGCCGCCCGCCTCGG + Intergenic
1072454097 10:95561223-95561245 AACAAAGGCGCCGCCCGCGGGGG + Intronic
1079054719 11:17195750-17195772 AAAAAAGGAGCCCCGCGCGCTGG + Intronic
1083119533 11:60497791-60497813 CACAGAGGAGCCTCCCTAGCTGG + Intronic
1089729385 11:120511289-120511311 CGCAAAGGGGCAGCCCGCCCCGG - Intergenic
1092180730 12:6445069-6445091 CAGAAAGGAGCCGCCTGGGCAGG + Exonic
1092229451 12:6768504-6768526 CAGAAAGGACCCCCCCGCCCAGG + Intronic
1097083149 12:56448170-56448192 CTCAAATGATCCGCCCGCGTCGG - Intronic
1103361464 12:120356868-120356890 CAGAAAGAAGCCGCAGGCGCAGG + Intronic
1122792086 14:104188233-104188255 CAGAAAGGAGGCGCCTGCCCAGG - Intergenic
1128705412 15:69834552-69834574 CACAAAGGAGCCCCACAGGCGGG - Intergenic
1132885933 16:2181944-2181966 CACAGAGGAGCCACCTGGGCTGG + Intronic
1132897461 16:2235874-2235896 CACCAAGGCGCCGCCAGGGCTGG - Exonic
1132956728 16:2598244-2598266 CACAAAGCTGCGGCCCCCGCAGG - Exonic
1142474374 17:180766-180788 ACAAAAGCAGCCGCCCGCGCCGG + Intronic
1142876306 17:2853679-2853701 CTCAGACGCGCCGCCCGCGCCGG - Intronic
1147816108 17:43212003-43212025 CACACAGGCGCCCCCCGCACGGG + Intronic
1148139096 17:45316228-45316250 CACTAAGGAGGCTCCCGGGCAGG + Intronic
1152074174 17:78148662-78148684 CCCGAAGGAGCCGACCGAGCAGG + Intronic
1152380885 17:79941793-79941815 GACACAGGAGCCTCCCTCGCTGG - Intronic
1152716222 17:81902086-81902108 CCCAAAGGAACCAGCCGCGCGGG - Intronic
1154360170 18:13654265-13654287 CACAAAGGAACCGCCCGCTCTGG + Intergenic
1160413346 18:78689276-78689298 CACAAAGGAGCTGCCAGGGTGGG + Intergenic
1164872995 19:31662223-31662245 CAAAAATGAGCCGCCCGTGGTGG + Intergenic
926070459 2:9884527-9884549 CAGAAAGGAGCTGCCCGCTGTGG - Intronic
926623694 2:15071336-15071358 CACAAAGGGGCCGGGCGCGGTGG + Intergenic
926906645 2:17811858-17811880 CACAAAGGAGCCGTATGGGCTGG + Intergenic
927544317 2:23939820-23939842 CACAAAGGGGCCGGGCGCGGTGG + Intronic
928254667 2:29711676-29711698 CACTAAGGAGCCACCTGCCCAGG + Intronic
933693611 2:85198523-85198545 AACAAATGAGCAGCCCTCGCTGG + Intronic
1172028887 20:31968088-31968110 GGAAGAGGAGCCGCCCGCGCAGG + Exonic
1174080777 20:47969372-47969394 CACAAAGGAGGCGGCTGGGCTGG + Intergenic
1174242956 20:49152961-49152983 CACAAAGGAGCCGGGCGTGGTGG + Intronic
1175887911 20:62302817-62302839 CGGAAAAGAGCCGCCGGCGCGGG + Intronic
1175909197 20:62396627-62396649 CACAAAGGCGGCACCCGGGCTGG - Intronic
1175967421 20:62666413-62666435 CACAAAGAAGCCGCCCAGGAAGG - Exonic
1178705060 21:34866170-34866192 CACAAAGGAGCCGTCTGCCCTGG + Intronic
1181459116 22:23075895-23075917 CACAAAGGAGCAGACCTCACAGG - Intronic
954851560 3:53605239-53605261 CACAAAGGAGCCCTCCACGGTGG - Intronic
957174549 3:76789349-76789371 TACGAAGGAGCAGCCTGCGCTGG + Intronic
966934762 3:184698808-184698830 CACAAATGAGCCGCCACCTCTGG + Intergenic
967222783 3:187262101-187262123 CACAAAGGAACCCCCTGGGCTGG + Intronic
969371455 4:6733960-6733982 CAGAAAGGACCAGCCCGAGCAGG + Intergenic
969697235 4:8741695-8741717 CATAAAGGAGGAGCCCCCGCTGG + Intergenic
978384799 4:108168380-108168402 GAAAAAGGAGCCACCCACGCTGG + Exonic
985754202 5:1703526-1703548 CACAAAGGTGCAGCCCTCCCAGG + Intergenic
991245712 5:64506560-64506582 AACAACCGGGCCGCCCGCGCCGG + Exonic
994083203 5:95731144-95731166 CACAAAGGAGCCGCCCGCGCGGG - Intronic
999287434 5:150402496-150402518 CACAAAGGAGCTGGCCCTGCTGG + Intronic
1021451130 7:20784842-20784864 CAACATGGAGCCCCCCGCGCCGG + Exonic
1025639683 7:63354512-63354534 CACGAGGGAGCTTCCCGCGCTGG - Intergenic
1025643016 7:63393580-63393602 CACGAGGGAGCTTCCCGCGCTGG + Intergenic
1029461096 7:100694214-100694236 CACAGAGGAGCGGCCGCCGCGGG - Intergenic
1041961468 8:63621965-63621987 CGCAAAGGACTCGCCCGCGGAGG - Intergenic
1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG + Exonic
1050964231 9:11777945-11777967 CACAAAGGATCCGCCCGCCTTGG - Intergenic
1061415589 9:130445287-130445309 CAGAAAGGACCCGGCTGCGCAGG - Intronic
1061663113 9:132143563-132143585 CACACAGGAGATGCCCGCTCGGG - Intergenic
1061975911 9:134067980-134068002 CAAAGAGGAGCCGGCCGCGCGGG - Exonic
1062513038 9:136917990-136918012 CACAAAGGATCTCCCCGTGCTGG + Intronic
1062695701 9:137875290-137875312 CACAGAGGAGCAGCCCGAGTGGG - Intergenic