ID: 994086891

View in Genome Browser
Species Human (GRCh38)
Location 5:95768865-95768887
Sequence GCACACAAGGTGCCACCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994086891 Original CRISPR GCACACAAGGTGCCACCAGG TGG Intronic
900376260 1:2356157-2356179 GCACAGATGGCACCACCAGGCGG - Intronic
902139812 1:14343531-14343553 TCACACATGGTGCCACAGGGAGG - Intergenic
902581445 1:17410230-17410252 CCACAAAAGGTGCCACCAGCAGG + Intronic
904433925 1:30482048-30482070 GCGCATAAAGTGGCACCAGGGGG - Intergenic
906683825 1:47749859-47749881 CCACACAAGTAGCAACCAGGCGG - Intergenic
907651993 1:56303942-56303964 CCACACAAGTGGCCACCATGTGG - Intergenic
912518336 1:110229434-110229456 GGACACCAGGTGCCGCCAGTGGG - Intronic
917054644 1:170967231-170967253 GTTCACTAAGTGCCACCAGGTGG + Intronic
920661044 1:207914577-207914599 GGCCAGAAGGTGCCACCAGTAGG + Intergenic
921031889 1:211341251-211341273 GCTGACAAGGAGCCACCAAGAGG + Intronic
921462593 1:215445784-215445806 GCAGACTAGATGCAACCAGGTGG - Intergenic
1069246619 10:66215186-66215208 GGACACTGGATGCCACCAGGAGG + Intronic
1070502464 10:77084434-77084456 GCACACAGGGTGTCACCAACCGG - Intronic
1077533466 11:3107999-3108021 TCCCCCAAGGGGCCACCAGGAGG + Intronic
1079510672 11:21206223-21206245 GCATACCAGGAGCCACCAGAAGG - Intronic
1083486136 11:62984033-62984055 GCACACAAGGTCCCACTGTGGGG + Exonic
1084030041 11:66475918-66475940 GCACATAAGGCCCCACAAGGCGG - Exonic
1084145458 11:67262847-67262869 GCCCACAAGGTGGCAGCACGAGG + Intergenic
1084410796 11:69005011-69005033 GTACAGAAGTTGCCCCCAGGTGG - Exonic
1087002533 11:93435203-93435225 GCAGTCAAGTTGCCACCAAGAGG + Intronic
1088826663 11:113500992-113501014 GCCCTCCAGGTGCCACCAGCAGG - Intergenic
1089270125 11:117296305-117296327 CCACCCAGGGTGCCACCAGTTGG - Intronic
1089386057 11:118068780-118068802 GCAGACACAGTGCCGCCAGGTGG - Intergenic
1091308873 11:134559083-134559105 TAACACAAGGTGTCACCTGGAGG + Intergenic
1097801670 12:63921233-63921255 GCACTCAAGGTGCAAACTGGTGG - Intronic
1100481168 12:94980740-94980762 GAACAGAAAGTGCCACCAAGTGG + Intronic
1103962865 12:124620323-124620345 GCAGCCATGGTGCCACCATGAGG + Intergenic
1107481587 13:40789860-40789882 GGACAAAAGTTCCCACCAGGTGG - Intronic
1108148111 13:47501081-47501103 GCACACAAGTGGCCAGCAGGAGG - Intergenic
1113169711 13:107486650-107486672 GCACACAAGGTGACAAAAGGAGG + Intronic
1116967563 14:51030309-51030331 GCACTAAAGGTGCAAGCAGGAGG - Intronic
1118477869 14:66135168-66135190 ACACAGTAGGTGCCTCCAGGTGG - Intergenic
1121992125 14:98568436-98568458 GGACAAAAGGCGCCCCCAGGAGG - Intergenic
1123783825 15:23649093-23649115 TGACAAAACGTGCCACCAGGGGG + Intergenic
1128218091 15:65948089-65948111 GCACAAAGGGAGTCACCAGGGGG - Intronic
1129065709 15:72902236-72902258 GCACACAGGCTGGCATCAGGCGG + Intergenic
1129908713 15:79208365-79208387 ACCCAGAAGATGCCACCAGGTGG - Intergenic
1130081238 15:80735498-80735520 GCACACAAGATCCGACAAGGTGG - Intronic
1132645778 16:998663-998685 GCACACCAGGTGCCACACAGTGG + Intergenic
1132833043 16:1938830-1938852 TCACTCTAGGTGCCTCCAGGAGG - Exonic
1134692887 16:16202598-16202620 ACACACAAGGAGACACCAGGGGG + Intronic
1134978960 16:18592097-18592119 ACACATAAGGAGACACCAGGGGG - Intergenic
1142292584 16:89199802-89199824 ACACACAAGGTTCCACTATGGGG + Exonic
1143022633 17:3924750-3924772 GGACACAAGGAGCCGGCAGGAGG - Intronic
1143682689 17:8489146-8489168 ACACACATGGTGTCAGCAGGAGG - Intronic
1144472825 17:15559973-15559995 CCAAACAAAGTGCCTCCAGGAGG + Intronic
1144715397 17:17431823-17431845 GCACTCAGGGTGGAACCAGGAGG + Intergenic
1144923655 17:18784732-18784754 CCAAACAAAGTGCCTCCAGGAGG - Intronic
1146927615 17:36755770-36755792 GCACACAAGGCACTGCCAGGGGG - Intergenic
1147217265 17:38908178-38908200 GCCCCGAAGGTGCCAGCAGGGGG - Intronic
1147244484 17:39111116-39111138 GCACACAAGGATGCACAAGGTGG - Intronic
1147794804 17:43034727-43034749 GCAGACAGGGAACCACCAGGAGG + Intergenic
1150606130 17:66692578-66692600 GCAAACAGGGTGCCATCAGTTGG + Intronic
1152635045 17:81427405-81427427 GCACACAGGCTGCCACCCAGGGG + Intronic
1152800861 17:82330081-82330103 TCACACAAGGAGACCCCAGGGGG + Intronic
1152944419 17:83191264-83191286 TCACACCAGGTGCCACCGTGTGG - Intergenic
1152944445 17:83191363-83191385 TCACACCAGGTGCCACCGTGTGG - Intergenic
1153624132 18:7007195-7007217 GAACACAAGGAGCAACCAGAGGG + Exonic
1156464069 18:37337466-37337488 GTTCAGCAGGTGCCACCAGGAGG + Intronic
1156597402 18:38563335-38563357 GCACACAAGAGGTCACCATGTGG - Intergenic
1160823913 19:1070778-1070800 GCACAGAAGGCGCCCCCAGCCGG - Intronic
1163557020 19:17998701-17998723 GCACACAGGCAGCCACTAGGCGG - Exonic
1166164098 19:40974728-40974750 ACAGACAAGTTACCACCAGGTGG + Intergenic
925013243 2:501911-501933 GCACACCAGGAGACCCCAGGTGG - Intergenic
925204311 2:1993280-1993302 GCACACAGGGGTCCGCCAGGTGG + Intronic
926773646 2:16400636-16400658 CCACACAAGGGGCCACAGGGAGG + Intergenic
927236133 2:20876574-20876596 GCACACTAGGTGCAACCAAAAGG + Intergenic
931534889 2:63263825-63263847 GCAAACAAGTGGCCACCAGCAGG + Intronic
938381596 2:130839276-130839298 GGACACCAGGAGGCACCAGGCGG - Intronic
942937991 2:181581705-181581727 GCAATCAACCTGCCACCAGGTGG + Intronic
946792271 2:223313176-223313198 GCAAACATTCTGCCACCAGGAGG - Intergenic
947661726 2:231874556-231874578 GCACAAAAGGAGCCCCCATGGGG - Intergenic
1169854156 20:10085263-10085285 GCAGCCAAGGTGCAGCCAGGAGG + Intergenic
1172290133 20:33770146-33770168 GCACATCAAGAGCCACCAGGAGG + Exonic
1181498276 22:23300668-23300690 GCTGCCAGGGTGCCACCAGGAGG + Intronic
1182446236 22:30391256-30391278 GTAATCAAGCTGCCACCAGGTGG + Intronic
1183321292 22:37166684-37166706 GCCCAGAAGTTGCCACCAGAGGG + Intronic
1183463140 22:37964956-37964978 GCAGGCAAGGAGCCACCAGATGG - Intronic
1185242236 22:49752764-49752786 GCCCACAGGCTGCCATCAGGTGG - Intergenic
953844433 3:46416209-46416231 GCACACCAGGTGCCAGGAGAAGG - Intergenic
955344899 3:58153584-58153606 GCCCACAAGGTGCGGGCAGGAGG + Exonic
955937040 3:64112057-64112079 GCACACATGGTTCCACCTGGTGG + Intronic
956841075 3:73140885-73140907 ACACTCAAGGTCCCACAAGGAGG - Intergenic
957560595 3:81815796-81815818 GGACACAAAGAGACACCAGGAGG + Intergenic
962363111 3:134757905-134757927 GCAGAGAAGGTGCAGCCAGGTGG + Intronic
963930908 3:151003537-151003559 GCACACAAGGTGAAGTCAGGAGG - Intergenic
969265860 4:6063764-6063786 CCACAGAAAATGCCACCAGGAGG + Intronic
969308601 4:6339515-6339537 GCACAGCAGGTGCTACCAAGAGG - Intronic
969544762 4:7818461-7818483 GGACACAAGCTGCCAACAGAAGG + Intronic
969857752 4:10013932-10013954 GAACAAAGGCTGCCACCAGGGGG - Intronic
971268353 4:25114153-25114175 GCATCCATGGTGCCAGCAGGGGG - Intergenic
973229365 4:47824329-47824351 ACACACACAGTGCTACCAGGAGG + Intronic
976002312 4:80387264-80387286 GCACATCAAGAGCCACCAGGAGG - Intronic
976897491 4:90128641-90128663 GTACACACGGTGCCAGCAAGGGG + Intronic
983733359 4:171025532-171025554 GAAGACAAGGAGGCACCAGGAGG - Intergenic
985682069 5:1261083-1261105 GCACACATGGTGTCTCCAGAGGG + Intronic
985846269 5:2351757-2351779 TCAAACAAAGTGCCACAAGGTGG - Intergenic
990248817 5:53891877-53891899 GCACTCCAGGTGCCAGCAGACGG + Intronic
992014330 5:72560355-72560377 GAACACAAGGACCCACCAGTAGG + Intergenic
994086891 5:95768865-95768887 GCACACAAGGTGCCACCAGGTGG + Intronic
995644535 5:114296279-114296301 GGGCCCAAGATGCCACCAGGAGG - Intergenic
996756970 5:126945644-126945666 GCACAATGGGTGCTACCAGGGGG + Intronic
997198176 5:131993596-131993618 TCACACATGGTGCCACCAAGGGG - Intronic
1001460826 5:171912312-171912334 TGACACCAGGTACCACCAGGGGG + Intronic
1001837719 5:174845825-174845847 GCACACCAGCAGCCCCCAGGTGG - Intergenic
1005712479 6:28515359-28515381 GCTATCAAGGGGCCACCAGGGGG + Intronic
1015695397 6:135974787-135974809 TCAGAAAAGGTGACACCAGGAGG - Intronic
1015832675 6:137387095-137387117 CCACACAAAAAGCCACCAGGTGG + Intergenic
1018555279 6:165043066-165043088 GGCCTCCAGGTGCCACCAGGTGG - Intergenic
1019656886 7:2200716-2200738 GCACAAACGGTGCTACCACGAGG + Intronic
1022284427 7:28941561-28941583 GCACAGATAGTCCCACCAGGAGG + Intergenic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1029559101 7:101290592-101290614 ACACAGAAGCTGCCAGCAGGGGG - Intergenic
1029624159 7:101709323-101709345 GCACACAAGGAGCCACCAGAAGG + Intergenic
1032128337 7:129210667-129210689 GGACAGAAGGTGCCACCAGGGGG - Intronic
1035344803 7:158191002-158191024 GCACAGAACGTGCCACCTTGTGG + Intronic
1037762577 8:21751659-21751681 CCACACAAGGTCCCGCAAGGTGG + Intronic
1038045135 8:23759939-23759961 GGACACATGATGCTACCAGGGGG + Intergenic
1038353001 8:26797903-26797925 GGACACAAGGTGTCTTCAGGTGG + Intronic
1041933245 8:63309756-63309778 GTACTCAGGGTGCTACCAGGAGG + Intergenic
1045057847 8:98384735-98384757 GCAGACATGGGGCCAGCAGGAGG - Intergenic
1048215236 8:132488003-132488025 ACACACAAGGAGACACCAGGGGG - Intergenic
1053051082 9:34960850-34960872 GCACGAAAGATGTCACCAGGTGG + Intronic
1060300299 9:122371131-122371153 GCATTCAAGGCTCCACCAGGAGG - Intronic
1060410697 9:123398294-123398316 GCACACAGTGTGCCATCATGAGG + Intronic
1060519256 9:124284737-124284759 GCAGAGAAAGTTCCACCAGGCGG - Intronic
1060965726 9:127711475-127711497 GCACAAAAGAGGCCACCAGAAGG + Exonic
1061756087 9:132813426-132813448 GGCCACAAGCTTCCACCAGGAGG + Intronic
1062379000 9:136277728-136277750 CCACAGAGGCTGCCACCAGGAGG + Intergenic
1193771487 X:85593091-85593113 GCATAGAAGCTGCGACCAGGAGG + Intergenic
1195658006 X:107351610-107351632 GCACATAAAATGCCACCAGTGGG + Intergenic
1202387977 Y:24343172-24343194 GCACACACTGTGTTACCAGGAGG + Intergenic
1202482810 Y:25326956-25326978 GCACACACTGTGTTACCAGGAGG - Intergenic