ID: 994087035

View in Genome Browser
Species Human (GRCh38)
Location 5:95770433-95770455
Sequence GTGACCACTGCTAAGAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 5, 3: 12, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994087035 Original CRISPR GTGACCACTGCTAAGAATGC AGG Intronic
905068146 1:35201291-35201313 GTGACTACAGCAAAGAATTCAGG - Intergenic
908682380 1:66676557-66676579 GGAACCACTGCATAGAATGCAGG + Intronic
909949300 1:81700799-81700821 ATTAGCACTACTAAGAATGCTGG + Intronic
912467084 1:109881752-109881774 GAGACCTCTGGTAAGAAAGCCGG - Intergenic
917496856 1:175548305-175548327 GAGACCCTTGCTAAGAATGAAGG + Intronic
918378520 1:183932699-183932721 GTGCCCACTGCAAAGCCTGCAGG - Intronic
922608203 1:226904345-226904367 GTGAGCAGTGCTAAATATGCAGG - Intronic
924714333 1:246558504-246558526 GTAACCACTACTAAGCAGGCAGG - Intronic
1064374473 10:14783146-14783168 GGGACCACTGCCATGTATGCGGG - Intergenic
1068949842 10:62765847-62765869 GTTACCACTGCTGAAAAGGCAGG + Intergenic
1073303925 10:102488045-102488067 ATGATCACTGCCAAGAGTGCTGG - Intronic
1074093445 10:110285656-110285678 GTGCCTAGTGCTAACAATGCAGG - Exonic
1074679744 10:115893116-115893138 GGAACCACTGCTGACAATGCAGG + Intronic
1077693012 11:4365841-4365863 TTGAAAATTGCTAAGAATGCAGG + Intergenic
1079348302 11:19671875-19671897 TAGACCAGTGCTAAGCATGCAGG - Intronic
1082207875 11:49460386-49460408 GTGAACACTGTTAAGAAAACAGG + Intergenic
1083959533 11:66006950-66006972 GGGACCACGGCTTGGAATGCTGG + Intergenic
1086647407 11:89241362-89241384 GTGAACACTGTTAAGAAAACAGG - Intronic
1091224568 11:133949846-133949868 GTGCCCACTCCTGACAATGCTGG - Intronic
1092383434 12:8017465-8017487 ATGACCATGGCTAAGAATGCAGG - Intergenic
1096216868 12:49802764-49802786 GTGACCACTGCTCAGAGACCTGG + Intronic
1097091889 12:56512428-56512450 ATGACCATTGCTAAGAATGCAGG + Intergenic
1097104290 12:56611979-56612001 GAGACCACTGAGAAGACTGCTGG + Exonic
1097243231 12:57590811-57590833 GAGACCACTGGTAAGAATTTTGG + Intergenic
1100088409 12:90939099-90939121 GTGACCACTGCTACCCATGGTGG + Intronic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1107221976 13:37993314-37993336 ATGACAATTGCTAAAAATGCAGG - Intergenic
1109066220 13:57696012-57696034 GAGACCACTGCTAACAGTTCTGG - Intronic
1109688794 13:65858355-65858377 GTGGCAACTGAGAAGAATGCAGG - Intergenic
1110295530 13:73859736-73859758 ATGACCACTGCACAAAATGCAGG - Intronic
1112973819 13:105292416-105292438 GTGGCCACTGATATGTATGCAGG - Intergenic
1116644145 14:47504825-47504847 GTAGCCACTACTAAGATTGCTGG - Intronic
1119230385 14:72974792-72974814 GTGACAACTGCTACGAAGCCAGG - Exonic
1121035816 14:90702814-90702836 GTGACATCTCCTAAGAGTGCTGG + Intronic
1131210716 15:90493419-90493441 GTGGCCAGTGCCAAGAAGGCTGG - Intronic
1133409250 16:5554840-5554862 GAGACAACTGCTCAGAAGGCAGG - Intergenic
1134301521 16:12995861-12995883 GTGACCACTATTATGAAAGCAGG - Intronic
1140423813 16:74843536-74843558 CTGACCCCTGCTAAGAATCAGGG - Intergenic
1142346002 16:89554315-89554337 GTGACCAGTGCCAGGAAAGCAGG - Intronic
1142931492 17:3288358-3288380 GTGACCACTGCCATGTATGCAGG - Intergenic
1143366269 17:6410656-6410678 GTGACCACCCCTAGGAATGAGGG + Intronic
1148461849 17:47843573-47843595 AAGGCCCCTGCTAAGAATGCAGG + Intergenic
1149551334 17:57542430-57542452 GTGACCAATGCTAAGGCTGTGGG - Intronic
1149669003 17:58388445-58388467 GTGACCACTGAGTACAATGCTGG + Intronic
1151339905 17:73464527-73464549 CTGACCACAGCTTAGAATGCCGG + Intronic
1155638540 18:27984325-27984347 GGAACCACTTCTAAGCATGCAGG - Intronic
1155706498 18:28822119-28822141 GTGTCCAATGCTAAGCATGGGGG + Intergenic
1159813156 18:73041315-73041337 GAGACAACTGCTAGGAAAGCAGG + Intergenic
1161302923 19:3551614-3551636 GTGACCACTCCCTGGAATGCTGG + Intronic
1165694958 19:37894026-37894048 GTGACAGCTGCTGAGAATGCTGG + Exonic
1165740466 19:38202289-38202311 TTGAACACTGCTAAGCAGGCCGG + Intronic
930593651 2:53358448-53358470 GTGTGAACTGCTAAGAATCCTGG + Intergenic
936740603 2:115502564-115502586 GTGACCACGGCTGAAAATACCGG + Intronic
939955065 2:148520891-148520913 GTGACCACTGCACGGAAGGCTGG - Intergenic
940289783 2:152067320-152067342 CTGACCACTGCTGAGAATACTGG - Intronic
940321273 2:152379328-152379350 GTGACCTCTGATATGACTGCTGG + Intronic
944241319 2:197487976-197487998 ATGACCATTGCTAAGAATGCAGG - Exonic
1171565621 20:26182844-26182866 GTGACTACTGATAAAACTGCTGG - Intergenic
1173441004 20:43076256-43076278 GTGTCCACTGCTAAGACTCCTGG + Intronic
1173637641 20:44574946-44574968 GAGACCACTGCTAATAATAAAGG - Intronic
1173813113 20:45968329-45968351 GTGACCAGTGCTGAGGATGGCGG - Exonic
1176990032 21:15484768-15484790 TTGACATCTGCTAAGAATGGAGG + Intergenic
1178064352 21:28887545-28887567 ATGACTATTGCTAAAAATGCGGG - Intergenic
1178510931 21:33204330-33204352 GTGGCCACTGCTCAAAATGTGGG + Intergenic
1178629790 21:34249468-34249490 GAAACCAATGCTAGGAATGCTGG - Intergenic
1181324053 22:22031235-22031257 GTGCCCACTGCTCAGAGTGCAGG - Intergenic
1181338829 22:22162444-22162466 GTGCCCACTGCTCAGAGTGCAGG - Intergenic
1181942404 22:26488564-26488586 GCTGCCACTGCAAAGAATGCTGG - Intronic
1182881665 22:33738928-33738950 TGGAACACTGTTAAGAATGCGGG - Intronic
1183010406 22:34941738-34941760 GTGACCAGTGCTAAAATTGAGGG + Intergenic
1184430346 22:44438618-44438640 GTGACCACAGCTAAGCTTCCCGG + Intergenic
952275062 3:31868905-31868927 GTGACCACATCAAAGAATGTAGG - Intronic
952744871 3:36767388-36767410 ATGACCATTGCTAAGAATGCAGG - Intergenic
952957164 3:38564604-38564626 GTGGCCAGTGCCAAGAAAGCTGG + Intronic
957750501 3:84408669-84408691 GGGACCATTGCTAAGTATGGAGG - Intergenic
960923854 3:122777652-122777674 GAGGCCACTGCTGAGAATGTAGG + Intronic
960924676 3:122782608-122782630 GAGGCCACTGCTGAGAATGTAGG + Intronic
970064067 4:12071309-12071331 GTCACCACTCCAAAAAATGCTGG + Intergenic
977099931 4:92798485-92798507 GGGACCACTGCTAAAAATATGGG + Intronic
978064642 4:104381581-104381603 GTGACCTCTGAGAAGAATGTGGG + Intergenic
980751154 4:137091182-137091204 GTGACCTCTGCTTTGAATACAGG + Intergenic
981446648 4:144847054-144847076 ATGACCATTGCTAAGAATGCAGG + Intergenic
981679805 4:147383895-147383917 GGGACCACTGGGAAGAAGGCAGG + Intergenic
983848371 4:172547188-172547210 GTGAGCAGTGGTTAGAATGCAGG + Intronic
984416419 4:179465441-179465463 GGGACCACTGCTATGAAAACCGG - Intergenic
986719216 5:10548444-10548466 GTGACCACTGGAAAGAAGCCAGG + Intergenic
987259774 5:16191611-16191633 GTCACCTCTCCTAAAAATGCAGG - Intergenic
987739226 5:21884019-21884041 ATGACCACTGCTACGAATGCAGG + Intronic
990992957 5:61702929-61702951 CTGCCCACTGCCAAGAATTCTGG - Intronic
993060259 5:83030118-83030140 GCTACCACTGCTAACTATGCAGG - Intergenic
993536716 5:89095638-89095660 GTGAACACTGCTAAGAAGTGTGG + Intergenic
994087035 5:95770433-95770455 GTGACCACTGCTAAGAATGCAGG + Intronic
997353285 5:133246167-133246189 GTCACCACTGATTACAATGCCGG + Intronic
999122401 5:149219331-149219353 GTGCCATCTGCTAAGAATCCTGG + Intronic
1000772131 5:165367972-165367994 GTGTCCACTGCTCAGAGTGTGGG - Intergenic
1011432238 6:87300184-87300206 GTGACTATTGTTAAGAATGCAGG + Intronic
1011974345 6:93276183-93276205 GTGCCCACTGGGAAGAATCCAGG - Intronic
1013646569 6:112148156-112148178 GTGAACTCTGCTAGGGATGCAGG - Exonic
1014069121 6:117161142-117161164 GTTACCACTGCTGAGGTTGCAGG + Intergenic
1018745520 6:166758682-166758704 GAGGCCACGGCTAAGGATGCAGG + Intronic
1019286007 7:223486-223508 GCAACCACTGCAAAGGATGCAGG + Intronic
1019606416 7:1912443-1912465 GTGGCCACTGCAGAGACTGCAGG + Intronic
1019733593 7:2639968-2639990 GTGACCACAGCTGAGGATGATGG - Intronic
1020749658 7:12124250-12124272 CTGAGCACTGGGAAGAATGCAGG - Intergenic
1022504068 7:30899752-30899774 GTGGTCACTGCTGGGAATGCTGG - Intergenic
1024001794 7:45194759-45194781 GTGACCCCTGTGGAGAATGCAGG + Intergenic
1024725568 7:52189867-52189889 GTGCACACTGCTGAGAATACTGG + Intergenic
1025810551 7:64872734-64872756 CTGACCACTTCTAGGAACGCGGG - Intronic
1026583585 7:71637789-71637811 GTGAGCAGTGCTAATATTGCTGG + Intronic
1032270302 7:130398915-130398937 GTGACCACTGCTGAGGGAGCGGG + Exonic
1036283339 8:7420265-7420287 ATGACAATTGCTAAGAATGCAGG + Intergenic
1036338131 8:7891256-7891278 ATGACTATTGCTAAGAATGCAGG - Intergenic
1036404381 8:8441847-8441869 GGGACCATTGCTCAGATTGCTGG + Intergenic
1040569000 8:48591711-48591733 GTGACCACTGCTGATGAAGCAGG - Intergenic
1042518466 8:69684349-69684371 GTGACCAGGGCTCAGAAAGCAGG - Intronic
1042778637 8:72465506-72465528 GTGAACACTCCTGAGGATGCTGG + Intergenic
1043854127 8:85245502-85245524 GTGACGACTCCTCAGAAGGCAGG + Intronic
1047163721 8:122412112-122412134 CTGAGCACTGCTTAGAATGAAGG + Intergenic
1048498329 8:134954244-134954266 GTGACCACAGCCATGAGTGCTGG - Intergenic
1050259357 9:3825189-3825211 GTTACCACTGATAAGAGTGTTGG - Intronic
1051764395 9:20506377-20506399 GGGACCACTGGTTAGACTGCTGG + Intronic
1060553809 9:124498331-124498353 GTGACCACTGCTCATAATCCCGG + Intronic
1185860649 X:3576025-3576047 GCAACCTCAGCTAAGAATGCAGG + Intergenic
1186943921 X:14543439-14543461 GAGACAACTGTTAAAAATGCTGG - Intronic
1190401742 X:50043432-50043454 GTCAGCACTGCTAAGATTGTGGG - Intronic
1192945874 X:75965160-75965182 GTGACCCCTGCAATGAATGATGG + Intergenic
1200804304 Y:7416567-7416589 GCAAACACAGCTAAGAATGCAGG - Intergenic