ID: 994087875

View in Genome Browser
Species Human (GRCh38)
Location 5:95780147-95780169
Sequence CAGCCTAGCTGTCCCTAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994087873_994087875 -1 Left 994087873 5:95780125-95780147 CCCAAATTCAGATTCTGCATATC 0: 1
1: 0
2: 7
3: 29
4: 307
Right 994087875 5:95780147-95780169 CAGCCTAGCTGTCCCTAATGTGG 0: 1
1: 0
2: 0
3: 6
4: 78
994087874_994087875 -2 Left 994087874 5:95780126-95780148 CCAAATTCAGATTCTGCATATCA 0: 1
1: 0
2: 0
3: 26
4: 249
Right 994087875 5:95780147-95780169 CAGCCTAGCTGTCCCTAATGTGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994087875 Original CRISPR CAGCCTAGCTGTCCCTAATG TGG Intronic
902464275 1:16605849-16605871 CAGCTTATCTGCCCCTACTGTGG - Intronic
922578326 1:226678352-226678374 CAGACTTGCTTTCCCTAAAGGGG + Intronic
1067064131 10:43094162-43094184 CAGGCCAGCTGTCCCTATGGGGG - Intronic
1067552991 10:47248064-47248086 CAGCCTGGCTGTGCCTGACGCGG - Intergenic
1073315996 10:102581298-102581320 CAGCCCAGATGCTCCTAATGGGG - Intronic
1076268799 10:129132620-129132642 CAGCTGAGCTCTCACTAATGAGG + Intergenic
1076832474 10:133003125-133003147 CTGCAAAGCTGTCCCTCATGGGG - Intergenic
1079912517 11:26329117-26329139 TAGCTTAGCTTTCCTTAATGAGG + Intronic
1080581770 11:33650297-33650319 CAGCCTTGCTGTACCAACTGTGG - Intronic
1085765596 11:79279135-79279157 CAGCCAAGGAGTCCCTAATGTGG - Intronic
1089262667 11:117232968-117232990 CAGCCTAGCAGTCCCCTGTGGGG + Intronic
1092979966 12:13784756-13784778 GAGCCCAGCTGTCCCAACTGAGG + Intronic
1096228694 12:49885413-49885435 CAGACTAGCTCTCCCGAATGTGG + Intronic
1103465310 12:121137840-121137862 CTGGCCAGCTGTCCCTACTGGGG + Intronic
1106158517 13:27179721-27179743 CAGTGTAACTGTCCTTAATGCGG + Intergenic
1113747180 13:112753248-112753270 GAGCCCAGCTGTCCATGATGTGG - Intronic
1113780632 13:112974896-112974918 CAGCCGAGCTTTCCATAATTAGG - Intronic
1114070037 14:19098781-19098803 CAGCGTAGCGGTCCCGAAAGTGG - Intergenic
1114092224 14:19301221-19301243 CAGCTTAGCGGTCCCGAAAGTGG + Intergenic
1123032513 14:105458606-105458628 CTGCCCATGTGTCCCTAATGGGG + Intronic
1127825448 15:62698758-62698780 CAGCCCAGCAGGCCCTGATGGGG + Exonic
1134856515 16:17524452-17524474 CAGCCAGGCTGGCCCTAAGGAGG + Intergenic
1135977347 16:27117441-27117463 CAGAATAGCTGTCCCTGATAAGG - Intergenic
1140344876 16:74203466-74203488 CATCCCAGCTGTCCCAGATGTGG + Intergenic
1140579813 16:76216659-76216681 CATCCAAGCTCTCCCTAATCTGG - Intergenic
1142013682 16:87731788-87731810 CAGCCGAGCTGTCCCTCAGTGGG + Intronic
1142434682 16:90048481-90048503 CTGCCTCCCTTTCCCTAATGAGG - Intergenic
1148512198 17:48180870-48180892 CAGTCTAGCTGACCTTAAAGTGG + Intronic
1148540452 17:48476226-48476248 ACGTCTAGCTGTCCCTAATGAGG - Intergenic
1149932453 17:60769583-60769605 CTGCCTAGCTGCTCCTACTGAGG - Intronic
1149943758 17:60899185-60899207 CAGCCTAGCTGTGGCCACTGAGG - Intronic
1151502700 17:74501779-74501801 AAGCCTGGCTCTCCCTTATGGGG + Intergenic
1153776985 18:8462986-8463008 CAGACCAGCTGTCCCTTCTGTGG - Intergenic
1159209522 18:65298683-65298705 CTGCCTAGTTGGCCCTAGTGAGG + Intergenic
1159677677 18:71306010-71306032 CTGCAAAGCTGTCCCTTATGGGG - Intergenic
1164729898 19:30495683-30495705 CAGCCCAGCTGTTCTTTATGGGG + Intronic
1164853586 19:31503769-31503791 CAGCCTAGCTGAGCCGTATGTGG - Intergenic
1167150550 19:47706916-47706938 CAGCCTGACTCTCCCTAATTAGG + Intergenic
928247318 2:29641880-29641902 CAGTTTTGCTATCCCTAATGGGG + Intronic
931533298 2:63242338-63242360 CATCCCAGCTGTACTTAATGTGG - Intronic
932507339 2:72247963-72247985 TAGACTAGCTGTCCCTGAGGAGG + Intronic
933942883 2:87259868-87259890 CAGACTGGCTTTCTCTAATGGGG - Intergenic
934970391 2:98758814-98758836 CAGCCTAGCTGTCCAAAAATAGG + Intergenic
935189414 2:100764509-100764531 CAGTCTACCACTCCCTAATGAGG + Intergenic
935271510 2:101438478-101438500 CAGCCTAGATGTCCTTCATTAGG - Intronic
935709180 2:105882025-105882047 AGGACTCGCTGTCCCTAATGAGG - Exonic
936337332 2:111601694-111601716 CAGACTGGCTTTCTCTAATGGGG + Intergenic
946130715 2:217604549-217604571 CAGCATGGCTGCCCCTCATGGGG - Intronic
1169285137 20:4301518-4301540 CAGCTTCCCTGTCCCTAATCAGG + Intergenic
1172626400 20:36349977-36349999 CAGCACAGCTGTGCCTGATGGGG - Intronic
1173298763 20:41782211-41782233 CAGCATAGCTGTTCCCAGTGTGG - Intergenic
1174503716 20:51003638-51003660 CAGCATGTCTGTCTCTAATGTGG - Exonic
1180488506 22:15821345-15821367 CAGCTTAGCGGTCCCGAAAGTGG - Intergenic
951858216 3:27221870-27221892 CAGCCAAGCCCTCCCTAAGGAGG - Intronic
953111908 3:39950584-39950606 CATCCTAGCTGTCCCAGCTGAGG - Intronic
955070815 3:55571237-55571259 CAGCCTAGCTGTAGCAAGTGTGG + Intronic
960269755 3:115660815-115660837 CAGCCTAGCCGTTCCACATGTGG - Intronic
960814582 3:121659661-121659683 CAGCTTGGCTTTCCCTGATGCGG + Intronic
962669336 3:137689368-137689390 AAGCCAAGCAGTCCATAATGGGG + Intergenic
971159112 4:24115063-24115085 CAGCATACCTTCCCCTAATGAGG + Intergenic
977056201 4:92194996-92195018 CAGCATAGCTGTTCCCAAAGAGG - Intergenic
982267795 4:153555829-153555851 CAACCTCGCTGTCCCTACTAGGG - Exonic
982656435 4:158155278-158155300 CTGCCAAGCTGTCCCTTGTGCGG + Intronic
986529999 5:8726524-8726546 CAGCCTGGCTGCCCATCATGTGG + Intergenic
991475261 5:67011659-67011681 GAGCCTGGCTGTCCCAACTGTGG + Intronic
994087875 5:95780147-95780169 CAGCCTAGCTGTCCCTAATGTGG + Intronic
1000800434 5:165719859-165719881 CATCCTAGCTGTCCCTGAGAAGG + Intergenic
1002212901 5:177609029-177609051 CCACCTATCTGTCCCCAATGAGG - Intronic
1006374940 6:33666895-33666917 CAGCCTATCCCTCCCTGATGCGG - Intronic
1014548404 6:122759180-122759202 GAGCCTAGATGTTCCTCATGGGG + Intergenic
1021140340 7:17016892-17016914 CAGCCTCGCTGTGCCTTATGGGG - Intergenic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1022044723 7:26613765-26613787 CAGCCTTGCTGTCCCTGCTCTGG - Intergenic
1031168304 7:118258558-118258580 CAACCTAGATGTCCATAAAGGGG - Intergenic
1035460250 7:159034176-159034198 CGGCCTGGCCGTCCCTGATGGGG - Intronic
1036490817 8:9223912-9223934 CAGGCTAGCTTTTCCTAATGGGG - Intergenic
1040301940 8:46192589-46192611 CAGCCTAGTTTTCGCTAGTGGGG - Intergenic
1044724319 8:95180694-95180716 CAGCCTAGCAGTCAGGAATGTGG - Intergenic
1050936452 9:11401789-11401811 CAACCAAGCTGTCTCTAATGAGG - Intergenic
1053728350 9:41026837-41026859 CCTCCTAGCTCTACCTAATGAGG + Intergenic
1054700155 9:68405243-68405265 CCTCCTAGCTCTACCTAATGAGG - Intronic
1055701531 9:78949938-78949960 CATCCCAGCTGTGCCTAAAGGGG + Intergenic
1059248721 9:112869172-112869194 CAACTCAGCTGTCCCTAAAGAGG - Exonic
1060652355 9:125339337-125339359 AAGCCCAGTTGTCCCTAATTGGG + Intronic
1195788907 X:108559912-108559934 GAGGGTAGCTGTCCCTTATGAGG + Intronic