ID: 994088518

View in Genome Browser
Species Human (GRCh38)
Location 5:95786351-95786373
Sequence CCAGTTTTGTACTGTGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994088515_994088518 17 Left 994088515 5:95786311-95786333 CCAGTAGCTCTCCAAATAATCAA 0: 1
1: 0
2: 1
3: 15
4: 144
Right 994088518 5:95786351-95786373 CCAGTTTTGTACTGTGTGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 153
994088516_994088518 6 Left 994088516 5:95786322-95786344 CCAAATAATCAAAATTTCTGAAC 0: 1
1: 0
2: 1
3: 25
4: 373
Right 994088518 5:95786351-95786373 CCAGTTTTGTACTGTGTGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 153
994088514_994088518 18 Left 994088514 5:95786310-95786332 CCCAGTAGCTCTCCAAATAATCA 0: 1
1: 0
2: 2
3: 17
4: 247
Right 994088518 5:95786351-95786373 CCAGTTTTGTACTGTGTGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994088518 Original CRISPR CCAGTTTTGTACTGTGTGTC AGG Intronic
900822615 1:4900841-4900863 CAAGTATTGTACTATGTGGCAGG - Intergenic
902952439 1:19896826-19896848 CCATTCTTGTGCTGTGTGTCAGG + Intronic
903494582 1:23756931-23756953 CCAGTGTTGTCCTGTGTTGCAGG + Exonic
905337800 1:37257459-37257481 CCAGTTTTGTCCTGTCTTCCAGG - Intergenic
911353898 1:96792256-96792278 CCATTTTTGTGTTCTGTGTCAGG + Intronic
912206420 1:107514188-107514210 CCAGTTTTGGACTATGTACCAGG + Intergenic
918606254 1:186430063-186430085 ACAGTTTTGTATTGTATGTAGGG + Intergenic
919022090 1:192119234-192119256 AAAGTTTTGTAATGTATGTCTGG - Intergenic
919530557 1:198713856-198713878 CAAGTTTTGAAGTGTATGTCTGG - Intronic
923979330 1:239302978-239303000 CCAGTGTTGCACTGAGTTTCCGG - Intergenic
1064412298 10:15117086-15117108 CCTTTTTTGTAATGTCTGTCTGG - Intronic
1066320483 10:34298431-34298453 TCCGTGTTGTAGTGTGTGTCAGG - Intronic
1066533938 10:36369985-36370007 ACAATTTAGTACTGTCTGTCTGG + Intergenic
1067682350 10:48449068-48449090 CCAGTTGTGTGCTGAGTGCCTGG - Intronic
1067782614 10:49219866-49219888 CCAGTTTTTTAAGGTGTGCCTGG - Intergenic
1068119257 10:52769771-52769793 CCAGGTTTGTTCTGTTAGTCAGG + Intronic
1068692088 10:59927189-59927211 CCAGTTTTGTTGTGCTTGTCTGG - Intergenic
1069485116 10:68817409-68817431 GAAGGTTTGTACTGTGTGGCGGG + Intergenic
1069787057 10:70995373-70995395 CCAGTGTTGGTTTGTGTGTCGGG - Intergenic
1070441372 10:76447745-76447767 CGAGTTTTATGCTGTGAGTCAGG + Intronic
1073555786 10:104449722-104449744 GCAATTTTAGACTGTGTGTCTGG + Intronic
1074408862 10:113206381-113206403 CCAGTTTTGTTCTTTGTGCTTGG - Intergenic
1074982853 10:118633627-118633649 CCAGTTCTGTACTAAGTGTGTGG - Intergenic
1079479866 11:20868031-20868053 TCAGTTGTTTACAGTGTGTCAGG + Intronic
1079861690 11:25680593-25680615 CAATTTTTGTATTGTGTGTATGG - Intergenic
1081301856 11:41462257-41462279 CTTGATTTGTACTATGTGTCTGG + Intergenic
1082022980 11:47550528-47550550 ACAGTTTTGTGATGTGGGTCCGG - Intronic
1083779130 11:64909188-64909210 CCAGTTTGGAACTGGGTGCCGGG - Intronic
1086953229 11:92911750-92911772 CCAGGTTTGTGCTGGGTCTCAGG + Intergenic
1088560301 11:111108484-111108506 CCAGTTATGTATTATGTATCTGG + Intergenic
1093688337 12:22082007-22082029 CCAATTTGGTCCTGTGTTTCTGG - Intronic
1094732391 12:33192899-33192921 CCAGGTTTGTACTTTTTCTCAGG + Intergenic
1098343042 12:69470853-69470875 CTAGTTTGGTATTCTGTGTCCGG + Intronic
1099391313 12:82082745-82082767 CCAGTTCTGTAGTTTGTGTCAGG + Intergenic
1100014027 12:89987223-89987245 TCAGTTTTGTAGTGTGGGTATGG + Intergenic
1100054169 12:90489315-90489337 TCAGTTTTATAGTGTGAGTCAGG + Intergenic
1101282466 12:103272754-103272776 CCAGTTTTCTCCTGTGTGTTTGG - Intronic
1104095627 12:125554911-125554933 TCAGTTTTTCAGTGTGTGTCAGG + Intronic
1104509020 12:129359166-129359188 ACAATATTGTACTATGTGTCTGG - Intronic
1104913020 12:132249031-132249053 TCAGGTTTCTACTGGGTGTCTGG + Intronic
1106417888 13:29561046-29561068 ACAGTTATGTACTGAGTGCCAGG + Intronic
1106978098 13:35246742-35246764 CTAGTTTTGTACTGGCTGGCAGG + Intronic
1107648933 13:42524829-42524851 CCAGTTGTGTACTGTGTGCTTGG + Intergenic
1108471011 13:50766872-50766894 CCAGTGTTGCTCTGTGTGTTTGG - Intronic
1109919242 13:69034607-69034629 CCTGTTTTTTACTGTGTTTCTGG - Intergenic
1112359780 13:98706968-98706990 CCAGTGTTCTACTGTAAGTCTGG + Intronic
1115369109 14:32592191-32592213 CTAGTTATGTGCTGTGTGCCAGG + Intronic
1115829096 14:37314917-37314939 CCTGTTATGTGCTGTGTGTTGGG + Intronic
1116409702 14:44607026-44607048 CCAGTTTTATGCTGTGAGTCTGG + Intergenic
1116942627 14:50805530-50805552 CCAGATTTGTGTTGTGTGTATGG - Intronic
1116999818 14:51361040-51361062 CCATTCTTGTAGTGTGTGTTTGG - Intergenic
1117766861 14:59092639-59092661 CCTGTTTTATAGTGTGTGCCAGG - Intergenic
1117936680 14:60914468-60914490 CCAGCTTTGAATGGTGTGTCTGG + Intronic
1118787443 14:69057838-69057860 GAAGTGCTGTACTGTGTGTCTGG - Intronic
1121837110 14:97102112-97102134 CCAGTTGTATGCTGTGTGCCAGG - Intergenic
1125334678 15:38615673-38615695 CCAGTTCTGCACTGTGCTTCGGG + Intergenic
1125515369 15:40316293-40316315 CCAGCTTGGTACTGCGTGGCTGG + Intergenic
1126287544 15:47030778-47030800 CCAGGTTTTTATTGTATGTCTGG - Intergenic
1127715454 15:61645009-61645031 CCAGGTGTTTACTGTGTATCAGG - Intergenic
1128979878 15:72178405-72178427 CCAGTTTCTGACTGTGTGTGAGG - Intronic
1134633471 16:15774352-15774374 CCAGTTTTGTGCTTTGCCTCTGG - Intronic
1135575819 16:23584861-23584883 CAAGTTTGGGACTGTGTGTTGGG - Intronic
1137778927 16:51080306-51080328 CCATTTTTCTAATGTGTGACAGG - Intergenic
1138885692 16:61075361-61075383 CGAGTTTTGCACTGTGTACCTGG + Intergenic
1140263608 16:73401460-73401482 CCATTTTTGCTCTGTGTGCCAGG - Intergenic
1141055703 16:80811783-80811805 ACAGTTTTTTTGTGTGTGTCGGG - Intergenic
1143206724 17:5146817-5146839 TCAGTTTTGTCCTTTGTCTCAGG - Intronic
1151184387 17:72352459-72352481 GCAGTATTGTACTGTGAGTTGGG - Intergenic
1152429252 17:80238587-80238609 CCAGCTTTGTATTGTCTGTGCGG + Intronic
1152481303 17:80555380-80555402 CCAGATTTCTAGTGTGTGTCCGG + Intronic
1152732702 17:81980419-81980441 CCAGTCTTCTACCTTGTGTCTGG + Intronic
1153426139 18:4966344-4966366 CCAGTTTTGTTCTTTTTCTCTGG - Intergenic
1153878715 18:9401684-9401706 CCAGTTTTATAATGTATTTCAGG + Exonic
1157507487 18:48238932-48238954 CCAGTTTGGTACTGTTGGTGGGG + Intronic
1158713053 18:59854231-59854253 TGAGTGTTTTACTGTGTGTCAGG + Intergenic
1160270359 18:77378148-77378170 CCAAGTGTGTACTGTGTGTACGG - Intergenic
1162113465 19:8413715-8413737 GCAGTTGCCTACTGTGTGTCAGG - Intronic
1162985591 19:14267329-14267351 CCAGGTATGTGCTGTGTGCCAGG - Intergenic
1164737999 19:30556164-30556186 TCTCATTTGTACTGTGTGTCCGG + Intronic
1167534190 19:50039139-50039161 CCAATAGTGTACTGTGTTTCAGG + Exonic
928193619 2:29196531-29196553 CCCAGTTTTTACTGTGTGTCTGG + Intronic
931002596 2:57804467-57804489 TCAGTTTTGGAATGTGTGTCAGG - Intergenic
931715566 2:65026134-65026156 CCATTGTTGTACTGTGTTTCTGG - Intergenic
932058384 2:68469307-68469329 CCAGTAGAGTACTGTGGGTCTGG + Intronic
935439568 2:103076285-103076307 CCAGTTGTGTATTTTGTGGCAGG - Intergenic
935623299 2:105147159-105147181 CCAGTTTTGTTTTGTTTGTGGGG + Intergenic
938206920 2:129431895-129431917 TCAGTTCTGTTCTGTGTGTGTGG - Intergenic
938213689 2:129490281-129490303 CCAGATGCGTACTGTGTGCCAGG + Intergenic
939366633 2:141241529-141241551 CCAGTTTTGTCCTGTTACTCCGG - Intronic
941352924 2:164458104-164458126 CCATTTTTTTACTGTCTGTAGGG + Intergenic
943117121 2:183686780-183686802 CCAGTTTTGTTCTTTTTCTCAGG + Intergenic
943514692 2:188869742-188869764 ACAGTTTTGTTCTGTGTCTGGGG + Intergenic
944972802 2:205013455-205013477 CCAGTGGTGTAGTGTCTGTCGGG + Intronic
945738545 2:213631924-213631946 CCAGTTTTGTTCTTTTTGTTTGG + Intronic
946771136 2:223090095-223090117 CCAGTATTTTAAAGTGTGTCTGG + Intronic
947065163 2:226216543-226216565 CCATTTTTGTCCTTTGTGTAAGG - Intergenic
1172889975 20:38257218-38257240 CCAGTTCCCTACTGTGTGCCAGG - Intronic
1173355314 20:42281741-42281763 CCAGTTCTGTTGTGTGTGTATGG + Intronic
1173597380 20:44267718-44267740 ACACTTCTGTACTGTGTGCCGGG - Intronic
1183233830 22:36600978-36601000 CCAGTTTTTCCCTGTGTGCCAGG + Intronic
952185004 3:30959159-30959181 CCAGTTTTGTAGTGTGCCTCTGG + Intergenic
953572573 3:44082961-44082983 CCAGTTTTCTACTTTGCTTCAGG + Intergenic
955194953 3:56796602-56796624 CCATTTTTTTCCTGAGTGTCTGG - Intronic
962683954 3:137828344-137828366 CCAGCTTTGTTCTGTCAGTCAGG - Intergenic
963615769 3:147535714-147535736 GCAGTTTTGTACTTTGAGTCTGG + Intergenic
964409543 3:156383499-156383521 CCAGTTTTGCACTGAAAGTCTGG + Intronic
965236522 3:166131377-166131399 CCAGTTTTGTTCTTTTTGTTTGG + Intergenic
965930032 3:174030977-174030999 CCAGTTTTATACTGTAGGCCAGG - Intronic
967985770 3:195094502-195094524 CCAGCTTTGTACAGGGTGTGGGG - Intronic
968074789 3:195810411-195810433 CAAGTTTTATTCTGTGTTTCTGG - Intronic
969288869 4:6225995-6226017 CCATTTTTGTCATGTGTGTTTGG + Intergenic
969416306 4:7061954-7061976 CCAGCTTTGTGATGTGTGGCAGG + Intronic
972718493 4:41673148-41673170 CTAGTTTTGTACTGTGGCTGGGG - Intronic
977050155 4:92119451-92119473 CCAGTTGTGAACTCTGTGTGAGG - Intergenic
977054127 4:92168048-92168070 CCAGTTTTGTTCTATATGACTGG - Intergenic
977239155 4:94545469-94545491 CCATTTTTGGTATGTGTGTCAGG - Intronic
977674350 4:99731655-99731677 CCAGTTTTTTTCTTTGTTTCAGG + Intergenic
979757304 4:124357797-124357819 CCAATTTTGTTCTTTTTGTCAGG - Intergenic
982997531 4:162368513-162368535 CCAGTTTTCCAGTGTGTGTATGG - Intergenic
983368526 4:166827773-166827795 CCAGATTTGAAGTGGGTGTCAGG - Intronic
984815227 4:183830229-183830251 CCAATTTTCTACTGTGTGCAAGG - Intergenic
987851547 5:23361795-23361817 ACAGTTTTGCACTGTGTGGCTGG - Intergenic
990404974 5:55480026-55480048 ACACTTTTGTACACTGTGTCTGG - Intronic
992827007 5:80559769-80559791 CCAGATTTGTCCTGTATGTTGGG + Exonic
994088518 5:95786351-95786373 CCAGTTTTGTACTGTGTGTCAGG + Intronic
1000491898 5:161924370-161924392 CTAGTTTCTTACTATGTGTCAGG + Intergenic
1001396564 5:171422461-171422483 CCATTTTTGTGCAGTGTTTCAGG - Intronic
1004704650 6:18113049-18113071 CCAGTTTTGTTCTTTTTGGCTGG - Intergenic
1004952733 6:20692659-20692681 TCAGTTTTGTACTTTTTTTCTGG + Intronic
1010900824 6:81425057-81425079 ACAGTATTGTTCTGTTTGTCTGG + Intergenic
1015881193 6:137871389-137871411 CCAGTTTTGTCCTCAGTTTCGGG + Exonic
1016158277 6:140842470-140842492 CAAGTTTTGTAATGTTTTTCAGG + Intergenic
1016406928 6:143740878-143740900 CCAGGTTCCTACTGTGTGACTGG + Intronic
1017265782 6:152443713-152443735 CCATTTTGCTACTGTGTATCAGG + Intronic
1019422244 7:956144-956166 CCCGTTTTGGTCTGTGTCTCTGG + Intronic
1022821887 7:33970307-33970329 CTTGTTTTGTTCTGTGTTTCAGG + Exonic
1024122665 7:46260789-46260811 ACTGTTTTATACTGTGTGTCTGG - Intergenic
1024538041 7:50454569-50454591 CCAGTTTGGTACAGTATGTAAGG + Intronic
1024931724 7:54671492-54671514 CCAGTTGTGTCCTGTGTCACAGG - Intergenic
1024948790 7:54837229-54837251 CCAGTTAAATGCTGTGTGTCTGG - Intergenic
1027495466 7:78882429-78882451 CCAGTTTTTCTGTGTGTGTCTGG - Intronic
1027534660 7:79382442-79382464 CAAGTTGGGTACTGTATGTCTGG - Intronic
1028223715 7:88225457-88225479 GCAGTTTTGTACTTTGAGTAGGG + Intronic
1029046066 7:97630135-97630157 GCAGTTTTGAAGTGTGTTTCAGG + Intergenic
1030516022 7:110538803-110538825 CCAGTTCTTTACTCTGTGACTGG - Intergenic
1032374002 7:131391543-131391565 CCACATTTCTACTGTGTGGCAGG + Intronic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1034528033 7:151678442-151678464 CATGTTTTGTTTTGTGTGTCCGG + Intronic
1038668611 8:29563191-29563213 CCAGTATAGCACTGGGTGTCTGG + Intergenic
1040060964 8:43102483-43102505 CCTGTTTGGTACTTTGTGGCAGG + Exonic
1042706816 8:71672184-71672206 CGAGAGATGTACTGTGTGTCAGG - Intergenic
1045946983 8:107807603-107807625 CCAGTTTTGGTTTGAGTGTCTGG - Intergenic
1046806963 8:118489374-118489396 CCATTTTTGTGCTTTGTTTCAGG + Intronic
1046847336 8:118932783-118932805 CCAGGTAGGTACTATGTGTCTGG - Intronic
1046861418 8:119095953-119095975 CAAGTTTGGTAGTGTGTTTCTGG - Intronic
1049344933 8:142133827-142133849 CCTGTTTTGGTCTGAGTGTCTGG - Intergenic
1051219143 9:14830396-14830418 CTAGTTTTCTACTGTTTGCCTGG + Intronic
1051983282 9:23050125-23050147 CCATTCTTGTAATGTCTGTCTGG - Intergenic
1058553157 9:106137181-106137203 CCAGTTCTCTTCTGTGTGGCTGG + Intergenic
1058702740 9:107614323-107614345 CCAGTTTTCTAATCTGTGTCTGG - Intergenic
1058716605 9:107727912-107727934 TCTGGTTGGTACTGTGTGTCAGG + Intergenic
1186307962 X:8285131-8285153 CCAGTCATGAACTCTGTGTCTGG + Intergenic
1187461829 X:19493894-19493916 TCAGTTTTACACAGTGTGTCAGG - Intronic
1194542073 X:95186439-95186461 CCAGTTTTGTTCTTTTTCTCAGG + Intergenic
1195589190 X:106604143-106604165 CTTTTTTTGTACTGTCTGTCTGG - Intergenic
1200246169 X:154527178-154527200 CCAGCTTTGGCCTGTATGTCTGG + Intergenic
1200328829 X:155272800-155272822 CCAGTTTTGTTCTTTTTCTCAGG + Intergenic
1200747546 Y:6915792-6915814 CCAGTTTTCTGCTGGGAGTCCGG + Intronic