ID: 994088673

View in Genome Browser
Species Human (GRCh38)
Location 5:95788207-95788229
Sequence CAGAATGAGGAGAATGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994088668_994088673 2 Left 994088668 5:95788182-95788204 CCCTCCATTAGCAGCTATTGGAA 0: 1
1: 0
2: 0
3: 7
4: 103
Right 994088673 5:95788207-95788229 CAGAATGAGGAGAATGGAGCTGG No data
994088669_994088673 1 Left 994088669 5:95788183-95788205 CCTCCATTAGCAGCTATTGGAAC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 994088673 5:95788207-95788229 CAGAATGAGGAGAATGGAGCTGG No data
994088666_994088673 21 Left 994088666 5:95788163-95788185 CCTGCTTGCTTGGAGTTTTCCCT 0: 1
1: 0
2: 1
3: 27
4: 221
Right 994088673 5:95788207-95788229 CAGAATGAGGAGAATGGAGCTGG No data
994088670_994088673 -2 Left 994088670 5:95788186-95788208 CCATTAGCAGCTATTGGAACTCA 0: 1
1: 0
2: 1
3: 5
4: 112
Right 994088673 5:95788207-95788229 CAGAATGAGGAGAATGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994088673 Original CRISPR CAGAATGAGGAGAATGGAGC TGG Intronic
No off target data available for this crispr