ID: 994089018

View in Genome Browser
Species Human (GRCh38)
Location 5:95792102-95792124
Sequence GCAGGCAGGGCAGCAGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 7, 3: 45, 4: 493}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994089011_994089018 8 Left 994089011 5:95792071-95792093 CCAACTCCAAGGCAGGAAGCAGG 0: 1
1: 0
2: 5
3: 71
4: 614
Right 994089018 5:95792102-95792124 GCAGGCAGGGCAGCAGCAACAGG 0: 1
1: 0
2: 7
3: 45
4: 493
994089013_994089018 2 Left 994089013 5:95792077-95792099 CCAAGGCAGGAAGCAGGTCCAGA 0: 1
1: 1
2: 3
3: 38
4: 375
Right 994089018 5:95792102-95792124 GCAGGCAGGGCAGCAGCAACAGG 0: 1
1: 0
2: 7
3: 45
4: 493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994089018 Original CRISPR GCAGGCAGGGCAGCAGCAAC AGG Intronic
900162884 1:1232632-1232654 GCAGCGCGGGCAGCAGCAGCAGG - Exonic
900671748 1:3858693-3858715 GCAGGGACGGGAGAAGCAACAGG - Intronic
900961056 1:5920424-5920446 GCCGCCAGGGCAGGAGCAGCTGG - Intronic
901525956 1:9823673-9823695 GCAGCCCGGCCAGCAGCAGCCGG + Exonic
901705752 1:11071729-11071751 GCATGCTGAGCAGCAGCAAGTGG - Intronic
901830131 1:11887165-11887187 CCTGGAAGGGCAGCAGCACCGGG + Intergenic
902214029 1:14923725-14923747 GCGGGCAGGGGAGCAGCCCCGGG - Intronic
902232408 1:15036331-15036353 GCAGGCAGGGCAGGGGGAGCCGG - Intronic
902609356 1:17588189-17588211 GCAGGCAGGGTGGCTGCCACGGG + Intronic
902950954 1:19882539-19882561 GCCGGCCGGGCAGCGGCAGCCGG + Exonic
903005687 1:20296953-20296975 GCAGGCAATGCAGAAGCAAGAGG - Intronic
903061311 1:20670682-20670704 GCAGGCAAGACAGCAGCCAAGGG + Intronic
903224511 1:21887147-21887169 GAAGGCGGGGCAGGAGCAAGCGG + Intronic
903543998 1:24112255-24112277 GCCTGCTGGGCAGCAGCGACAGG + Intergenic
903953388 1:27009547-27009569 ACAGGCTGGACTGCAGCAACTGG - Intronic
903972296 1:27126927-27126949 GCAGGCAAATCAGCAGCATCTGG + Intronic
904364500 1:30001796-30001818 GGGGGCTGGGCAGCAGCACCAGG - Intergenic
904624426 1:31794050-31794072 GCGTGCAGTTCAGCAGCAACAGG - Intronic
904941901 1:34169687-34169709 GCAGGCAGGGCTGCAGAGAAGGG + Intronic
905627592 1:39498838-39498860 GGAGGCAGGTCCACAGCAACGGG + Intronic
905668832 1:39778270-39778292 GGAGGCAGGTCCACAGCAACGGG - Intronic
905825126 1:41021168-41021190 GCAGGCAGAGAAGCTGCAATGGG - Exonic
906026270 1:42676635-42676657 GCAGGCAGGGAAGCAAAGACGGG - Exonic
907148439 1:52258873-52258895 GCAAGCAAGGGAGCAGCAAATGG - Intronic
908111586 1:60903746-60903768 GCTGGCCAGGCCGCAGCAACCGG - Intronic
910276020 1:85449772-85449794 GAAAGCATGGCAGCAGGAACAGG + Intronic
910553096 1:88498636-88498658 GCTGCCAGGGCAGCTGCAATGGG + Intergenic
911641780 1:100297616-100297638 GCAGGCAGTGCACCAGTTACGGG - Intergenic
912181101 1:107220152-107220174 GGAGGAAGGCCAGCAGCCACAGG + Intronic
912498638 1:110107320-110107342 GCAGGCAGGGGAGCAGCACCAGG - Intergenic
913216898 1:116628326-116628348 GTGGGGAGTGCAGCAGCAACAGG - Intronic
915310078 1:155002246-155002268 GCGGGCAGAGCAGCAGCAAAGGG + Intergenic
915440448 1:155942381-155942403 GCAGGAAGGCCAGCAGCAGCAGG - Exonic
919318005 1:195999644-195999666 GAAGGCAGGGCAGCAGGAGTGGG - Intergenic
919597194 1:199578926-199578948 CCAGGCAGGGCATCAGCAGATGG - Intergenic
920314820 1:205069882-205069904 GCAGGCAGGGCAGCACTCACTGG + Exonic
920674130 1:208027290-208027312 GCAGGCACGGCGGCAGCGGCTGG - Exonic
920957603 1:210633513-210633535 GAAGGCAGGTGAGCAGAAACAGG + Intronic
921148139 1:212378508-212378530 GCAAGCAGGGAGGCAGCTACAGG - Intronic
921406875 1:214790036-214790058 GCTGGCAGGGCAGCAGAAGTAGG + Intergenic
922618929 1:226978989-226979011 GAGAGCAGGGCAGCAGCAAAAGG - Intronic
922645546 1:227282505-227282527 GCACACACTGCAGCAGCAACAGG + Intronic
922812181 1:228423244-228423266 GCAGAGTGGGCAGCAGCCACAGG + Intergenic
923149649 1:231221637-231221659 GCAGACAGGGCAGAGGCTACAGG + Intergenic
923566999 1:235083744-235083766 GGGAGCAGAGCAGCAGCAACAGG + Intergenic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1062934374 10:1375018-1375040 GCAGGCTGGGCAGCTGCAGAAGG + Intronic
1063029448 10:2217920-2217942 TCAGACAGGGAAGCAGTAACAGG - Intergenic
1064285269 10:13985922-13985944 TCTGGCAGGACAGCACCAACTGG + Intronic
1064408859 10:15088461-15088483 GCAGGCAAGGCAGGAGCGCCGGG - Intronic
1064586321 10:16842881-16842903 GAAGGAAGAGCAGCAGGAACAGG - Intronic
1065866743 10:29921103-29921125 CCTGGAAGGGCAGCAGCAGCTGG + Intergenic
1066389080 10:34964362-34964384 GCAGGCAGAGCGGCAGCCGCAGG + Intergenic
1067462214 10:46466096-46466118 GCAGGCAGGGCTGCAGTTCCGGG - Intergenic
1067624982 10:47918502-47918524 GCAGGCAGGGCTGCAGTTCCGGG + Intergenic
1069019157 10:63466033-63466055 GCGGGCGGGGCAGCAGCCGCGGG + Intergenic
1069043401 10:63718093-63718115 GCTGGCAGGTCGGCAGCAAGTGG + Intergenic
1069634944 10:69919277-69919299 GCAGGCATGCCAGCTGCAGCAGG + Intronic
1070753439 10:78977193-78977215 GGAGGCAGGGCAGGGGCAGCAGG - Intergenic
1070957994 10:80477122-80477144 GAAGGCAGAGAAGCAGCAGCAGG - Intronic
1071974933 10:90945902-90945924 GCAGGCATGGCAGTTGCAGCTGG - Intergenic
1072572035 10:96666879-96666901 GGAGGCAGGGCAGTGGCACCTGG - Intronic
1072781098 10:98252485-98252507 GCTGTCAGTGCGGCAGCAACAGG + Intronic
1073382191 10:103087254-103087276 GTAGGCAGGGCAGCTGTAACTGG - Exonic
1074814533 10:117134433-117134455 GCAGGCCGGGCGGCGACAACAGG + Exonic
1075060231 10:119252098-119252120 CCACGCAGGCCAGCAGCAAGAGG - Intronic
1075077243 10:119359591-119359613 GCAGCCAGGGCCACAGCATCTGG - Intronic
1075103762 10:119523898-119523920 GCTGGCAGGGCAGCCACACCTGG - Intronic
1076136311 10:128047412-128047434 GCAGCCAGGCCAGCAGCGGCTGG - Exonic
1076203032 10:128573119-128573141 ACAGGCAGGGCAGCAGCACCGGG + Intergenic
1076345897 10:129778843-129778865 GCAGGCGGGGCAGAGGCAGCAGG - Intergenic
1076463983 10:130665970-130665992 GCAGGCAGGGCTGGGGCAACAGG + Intergenic
1076756871 10:132577144-132577166 CCAGGCAGGGCCGCTGCACCTGG + Intronic
1076904636 10:133355893-133355915 GCAGGGAGGGCACCAGGAAGTGG + Intronic
1077141405 11:1026485-1026507 GGAGGCAGGTCAGCAGCTCCTGG + Intronic
1077401286 11:2359065-2359087 GAAGGCAGGGGAGCAGCAGTGGG - Intergenic
1078168790 11:8912624-8912646 GAAGGCTGGGCAGGAGAAACAGG - Intronic
1080448265 11:32357156-32357178 GCAGGCAGAGCTGCTGCAAGAGG + Intergenic
1081806119 11:45891544-45891566 GCAGGCAGCCCAGCAGCAGACGG + Intronic
1083014289 11:59436813-59436835 GCAGACAGAGCAGGAGCAACAGG + Intergenic
1083734314 11:64670923-64670945 GAAGCCAGGGCACCAGCCACTGG + Intronic
1083827998 11:65213944-65213966 GGCCGCAGGGCAGCAGCAGCAGG - Intergenic
1084010823 11:66347437-66347459 GCAGTCCGGACAGCAGCGACAGG + Exonic
1084012910 11:66362641-66362663 GCAGGAAGAACAGCACCAACAGG + Exonic
1084363399 11:68683624-68683646 GTGGGCAGAGCAGCAGCAAGAGG - Intergenic
1085273074 11:75281776-75281798 TCAGACAGGGCAGCAGGTACGGG - Intronic
1085405874 11:76261856-76261878 GCAGTCAGGGGAGCAGGCACAGG + Intergenic
1087007632 11:93484888-93484910 GCAGCCAATGCAGCAGCCACCGG + Intronic
1087204449 11:95379089-95379111 GGAGGAAGTGCAGCAGGAACAGG - Intergenic
1088659329 11:112029743-112029765 GCAGGCAGGGAAGCAAACACAGG + Intronic
1089189621 11:116644471-116644493 ACAGGCAGGAGAGCAGCAACAGG + Intergenic
1089574617 11:119432547-119432569 GCCGACTGGGCAGCAGCATCTGG + Intergenic
1090236121 11:125148661-125148683 GCTGGGAGGGCATCAACAACAGG - Intergenic
1090421911 11:126581065-126581087 GGAGGCAGGACAGCAGCCATGGG + Intronic
1091330310 11:134726736-134726758 GCAGCCAGTGCAGAAGCACCTGG + Intergenic
1091558504 12:1593871-1593893 GCAGGCTGGGGAACAGCGACGGG + Exonic
1092226343 12:6750547-6750569 GCAGGCATGACAGCAGGTACAGG + Intronic
1092390081 12:8069267-8069289 CCAGGCAAGGTAGCAGCCACTGG - Intergenic
1092680024 12:10968797-10968819 GCAGGCCCCGCAGCAGCATCTGG + Intronic
1095295104 12:40518510-40518532 GCAGGCATCACTGCAGCAACAGG + Intronic
1095925668 12:47576523-47576545 GCAGCCTGGGCTGCACCAACAGG + Intergenic
1096413455 12:51393002-51393024 GGAGGCGGGGCAGCAGAAAGAGG - Intronic
1096439308 12:51626125-51626147 CAAGGCAGGGCAGGAGAAACAGG + Intronic
1096443015 12:51662007-51662029 GCAGGCAGAGCAGCAGCAGAAGG - Intronic
1096473961 12:51896718-51896740 GCAGACAAGCCATCAGCAACGGG + Intergenic
1096536058 12:52275569-52275591 GCAGGAAGGGCAGCAACACAGGG - Intronic
1096580332 12:52580885-52580907 CCAGGCAGGGCAGAAGCACTAGG + Intergenic
1096786526 12:54019929-54019951 GAAGGCATAGCAGCAGCGACCGG + Intronic
1096983711 12:55743331-55743353 GCAGGAAGCCCAGCAGCAGCGGG - Exonic
1097451679 12:59744452-59744474 GCAGGAAGGGGAGCTGCAAAGGG - Intronic
1100455016 12:94743221-94743243 GCAGGCAGGGCAGAAACTATTGG + Intergenic
1101015331 12:100494680-100494702 GCAGGCAGGCCAGAAGCAAATGG - Intronic
1101637956 12:106561837-106561859 ACAGGCATGGCACCAGCATCCGG - Intronic
1101660259 12:106759221-106759243 GCAGGCATGGCAGGAGCCAGGGG + Intronic
1101750825 12:107581260-107581282 CCACGCCGGGCAGCAGCAGCCGG - Exonic
1102211189 12:111128437-111128459 GAAGGCAGTGCAGCAGGAATGGG + Intronic
1102284428 12:111644208-111644230 CCAGGAAGGGCCGCAGCAAGAGG - Exonic
1103321313 12:120094122-120094144 GCAGGCAGGCAGGCAGCATCTGG - Exonic
1103731913 12:123033369-123033391 GCAGCCAGGACTGCAGCAAGTGG + Intronic
1103977556 12:124713403-124713425 GCAGGGAAGGCAGGAGGAACGGG + Intergenic
1104539626 12:129651691-129651713 GAAGCAAGGACAGCAGCAACTGG + Intronic
1104644141 12:130485136-130485158 GCAACCAGGGCTGCACCAACAGG + Intronic
1104687076 12:130793473-130793495 GCAGGCAGCACAACAGCAGCAGG - Intronic
1104762302 12:131304771-131304793 CCAGGCACCGCATCAGCAACAGG - Intergenic
1104817474 12:131656025-131656047 CCAGGCACCGCATCAGCAACAGG + Intergenic
1106026324 13:25959143-25959165 GCAGGCAGGACAACAGGAGCTGG + Intronic
1106448856 13:29861737-29861759 TCAGGCAGGGCTGCTGCAAAGGG + Intergenic
1106847090 13:33748243-33748265 GCAGGCAGGTGAGCAGGTACAGG + Intergenic
1107872913 13:44763637-44763659 TCAGGCAGGACAGCTGCACCTGG - Intergenic
1108556220 13:51595506-51595528 ACAGGCAGAGCAGGAGCAAGGGG - Intronic
1109426101 13:62167909-62167931 GCAGGTTAGGCAGCGGCAACTGG - Intergenic
1109679999 13:65739031-65739053 TCAGGGAGGGTAGCAGGAACGGG + Intergenic
1110646643 13:77893291-77893313 GCAGGCCGGGCTGTAGAAACAGG - Intergenic
1111606425 13:90545725-90545747 GCAGGAAGGGCAGCTGAAAAGGG + Intergenic
1113288781 13:108883033-108883055 GAAAACAGGGCAGCAGCAAGGGG - Intronic
1113584790 13:111457898-111457920 GAATGCAGGGGAGCAGCACCAGG + Intergenic
1113790769 13:113026871-113026893 GCGGGCAGGAGAGCAGCATCAGG + Intronic
1114080851 14:19200600-19200622 GCAGCCAGGGCAGGAGCATGAGG - Intergenic
1114550721 14:23531425-23531447 GCAGGGAGGGCAGCAGGATGTGG - Intronic
1114733365 14:25018218-25018240 GCAGGCAAGTCAGAAGCCACGGG - Intronic
1116389380 14:44374912-44374934 GCAGGAAGGGAAGCAGGAACAGG - Intergenic
1118014278 14:61642557-61642579 GAAGGCAGGGCAGCAGTCAGTGG + Intronic
1118180392 14:63486660-63486682 GGAGGCAGGAAAGCAGGAACAGG - Intronic
1119706158 14:76783794-76783816 GGAGGCATGGCAGCAGGAAAAGG + Intergenic
1119726526 14:76924863-76924885 GAAGGGAGGGCGGCAGCCACAGG - Intergenic
1119825410 14:77653664-77653686 GGAGGAAGGGCAGCAGGGACGGG + Intergenic
1119840712 14:77790778-77790800 GCAGGAAGGGCAGCAGCAGCTGG + Intergenic
1120739906 14:88096694-88096716 GAAATCAAGGCAGCAGCAACAGG + Intergenic
1121528896 14:94638881-94638903 GCAGTCAGGGCAACAGGGACTGG - Intergenic
1121623916 14:95371147-95371169 GCAGGCAGGGCAGCCTGGACGGG - Intergenic
1122812964 14:104297996-104298018 GCAGGCAGGGCCGCAGCCCCAGG + Intergenic
1122967469 14:105138051-105138073 GCAGGCCAGGCAGCAGCAGCTGG - Intergenic
1124043640 15:26127788-26127810 GCAGGCAGGGCAGCTGCCTTGGG - Intergenic
1124382212 15:29176597-29176619 ACATGCAGGGCAGGAGCCACGGG + Intronic
1126347160 15:47708345-47708367 GCAGAGAGGGCAGCAGAATCAGG - Intronic
1128213015 15:65915492-65915514 GAAGCCAGGGCTGCAGTAACAGG + Exonic
1128565658 15:68699186-68699208 GCAGGAAGGGCAGCTGCGAAGGG + Intronic
1129029761 15:72609688-72609710 GCAGGAGGGGCTGCAGGAACAGG + Intergenic
1129200809 15:73998072-73998094 GCAGACAAGGCAGCAGCTTCGGG - Exonic
1129364554 15:75046364-75046386 GCTGGCGGGTCAGCAGCAGCTGG + Intronic
1130908179 15:88254353-88254375 GCAGGGAGGGCAGGAGGAACAGG - Intronic
1131117521 15:89804124-89804146 CCTGGCAGGGCAGCAGGAAGGGG - Intronic
1131260921 15:90887305-90887327 GCAGGCCGGGCAGCAGGAGCTGG - Exonic
1131670229 15:94611875-94611897 GCAGGCAGAGCAGGTGGAACTGG + Intergenic
1131721189 15:95170588-95170610 ACAGGCAGGGCAGCAGGTCCCGG + Intergenic
1132214101 15:100050105-100050127 CCATGTGGGGCAGCAGCAACTGG - Intronic
1132548505 16:544488-544510 GCAGCCGGGACAGCAGCACCCGG - Intronic
1132728968 16:1351449-1351471 GCAGGCAGCGCACCAGCCCCAGG + Exonic
1132903534 16:2270979-2271001 GCAGGCACTGCAGGAGCCACCGG - Intergenic
1133234435 16:4381369-4381391 GCAGGCGGGGCAGGCGCAGCGGG - Exonic
1133689892 16:8203298-8203320 CCAGCGAGGGCAGCAGCAATGGG + Intergenic
1133728334 16:8557426-8557448 GCAGGCAGTGGAGCAGCTAGGGG - Intergenic
1134013645 16:10873535-10873557 GAAGGCAGGAGAGCAGCACCGGG + Intergenic
1135716753 16:24777129-24777151 GCAGCCACAGCAGCAGCCACAGG + Exonic
1136173798 16:28504021-28504043 GGAGCAAGGGAAGCAGCAACAGG + Exonic
1137043899 16:35638934-35638956 TCAGGCAGGGCAGGAGAGACTGG + Intergenic
1137744684 16:50812158-50812180 GGAGGCAGGGCTGCACCCACGGG + Intergenic
1139432090 16:66916273-66916295 GCAGGCAGAGTACCAGCTACAGG - Exonic
1139932397 16:70539140-70539162 ACACACATGGCAGCAGCAACGGG - Exonic
1140067970 16:71626354-71626376 GCAGGAAGCGAAGCAGCGACGGG + Exonic
1141535574 16:84677554-84677576 GCAGGCTGGGATGCAGCAGCAGG + Intergenic
1141614144 16:85200886-85200908 GCAGCCAGGGCTGCAGGAAGTGG - Intergenic
1142126499 16:88413232-88413254 GAAGGCAGAGCAGCAGGAAATGG + Intergenic
1142172581 16:88630641-88630663 CCAGGGAGGCCAGCAGCAGCAGG + Intronic
1142198394 16:88749411-88749433 GGAACCAGGGCAGCAGCAGCAGG + Exonic
1142200141 16:88757263-88757285 GCTGGCAGCGCAGCAGCACCTGG + Intronic
1142346595 16:89557979-89558001 ACAGGGAGGGCAGAAGCAAGGGG - Intergenic
1142697312 17:1640563-1640585 GCAGGCAGGGCTGCTGGCACTGG + Exonic
1143336902 17:6178247-6178269 GCAGGAAGGGCAGTGGCAACTGG + Intergenic
1143670532 17:8393032-8393054 GCAGGCTGGGCAGCAGGTCCAGG + Exonic
1144761743 17:17711080-17711102 GAAGGCAGGGCCGCAGTACCCGG + Intronic
1144830133 17:18126600-18126622 CCAGGCAGGGCCGAAGCTACAGG + Intronic
1144848226 17:18231018-18231040 GCACGCAGCGCAGCACCCACAGG - Intronic
1144864228 17:18324542-18324564 GCAGGCCGGGCCTCAGCAGCAGG - Intergenic
1145029727 17:19495452-19495474 GGAGGCCGGGCAGGAGCAGCAGG - Intronic
1145775460 17:27524807-27524829 GCAGGCAGAGCGGCAGGAAAAGG + Intronic
1145980041 17:29005833-29005855 GCAGCGAGGGCAGGAGCAGCAGG + Exonic
1145990403 17:29075882-29075904 GGAGGCAGGGCTGCAGCTCCAGG - Exonic
1147511438 17:41072273-41072295 GCAGACTGGACAGCAGCAGCTGG - Intergenic
1147519789 17:41160017-41160039 GCAGTTGGGGCGGCAGCAACTGG + Exonic
1147520512 17:41167921-41167943 GCAGGAAGGCCTGCAGCAACTGG + Exonic
1147520526 17:41168011-41168033 GCAGGAAGGCCTGCAGCAACTGG + Exonic
1147522231 17:41184708-41184730 GCAGGATGGGCGGCAGCAGCTGG + Exonic
1148102017 17:45098061-45098083 GCATGCAGGGAAGCAGCACAGGG - Intronic
1148143518 17:45344953-45344975 TCAGGCAGGGAGGGAGCAACTGG - Intergenic
1149535350 17:57429427-57429449 GCAGGAAGGACAGCGGCAGCAGG - Intronic
1149551601 17:57544511-57544533 GCTGCCAGGGCAGTAGCAGCTGG + Intronic
1149662779 17:58344154-58344176 GAAAGCAGGGCAGCAGTACCAGG + Intergenic
1150221299 17:63497219-63497241 CCAGGAAGAGCAGCAGCCACTGG - Intronic
1151227513 17:72657995-72658017 GCAGGCACGGCAGAAGCAGAAGG + Intronic
1151540207 17:74760944-74760966 GCAGGCTGGACAGCAGCCAGTGG + Intronic
1151731451 17:75913948-75913970 GCAGGCGGTGCAGCAACAGCAGG - Exonic
1151924105 17:77181190-77181212 GCAGGGAGAGCATCAGCAAGAGG - Intronic
1152099033 17:78290341-78290363 GCAGGCTGGGCGGCAGCGGCAGG + Intergenic
1152271003 17:79324840-79324862 GCAGGCAGAGAAGCAGGAAGAGG + Intronic
1152301476 17:79497537-79497559 GCAGGAAGGCCAGAAGCCACCGG + Intronic
1152544992 17:80995903-80995925 GCAGGCAGGGATGCAGTGACCGG + Intronic
1152579065 17:81158006-81158028 GCTGGCTGGGCAGCAGCAGGGGG + Intronic
1152660911 17:81541486-81541508 CCAGGCAGGGAGGCAGCACCAGG - Intronic
1152720339 17:81920589-81920611 CCAGGAAGGGCAGCAGCCTCTGG + Exonic
1153060136 18:986328-986350 GCAGGCAGAGCAGCAGAAGGTGG + Intergenic
1155505457 18:26528556-26528578 GCAGGCAGCAGAGCAGCAGCTGG - Intronic
1156472001 18:37383241-37383263 CCAGGCAGAGCAGCGGCCACTGG + Intronic
1156570289 18:38244766-38244788 GCAGGCAGGGCAGGACCAGGTGG + Intergenic
1158293748 18:55971220-55971242 GCAGCAAGGACAGCAGCAGCAGG - Intergenic
1159601132 18:70429905-70429927 TCAGGCAGGGCGGCCGCAAGTGG + Intergenic
1160075312 18:75668873-75668895 GGAGGCAGGTCAGTGGCAACAGG + Intergenic
1160114749 18:76066944-76066966 GAAGGCAGGGAATCAGCAATTGG - Intergenic
1160152096 18:76403014-76403036 GCAGGTGGCTCAGCAGCAACTGG - Intronic
1160535572 18:79589755-79589777 GCGGGGAGGGCAGCAGGGACAGG - Intergenic
1160903505 19:1440910-1440932 GCAGGAAGTGAAGCAGCAGCAGG + Exonic
1160931696 19:1573584-1573606 GCAGGCAGGACAGCAGAGACAGG + Intronic
1160954243 19:1682834-1682856 GCCTGCAGGGAACCAGCAACGGG - Intergenic
1161283826 19:3458940-3458962 CCAGTCAGGGCAGCAGCAATGGG - Intronic
1161439259 19:4281037-4281059 GTAGGAAGGGCAGCATCACCGGG - Intronic
1161898710 19:7101647-7101669 GGTGGCAGGGCCGGAGCAACAGG - Intergenic
1162054205 19:8053055-8053077 CCAGGCAGGCCAGGAGCCACAGG - Exonic
1162463867 19:10829554-10829576 GCTGGAGGGGCAGCAGCCACAGG + Intronic
1162794808 19:13081549-13081571 GCAGGTAAGGCAGCCGCCACAGG - Intronic
1163000481 19:14363694-14363716 ACAGGCAGGGCAGCTGGAGCCGG - Intergenic
1163007770 19:14407196-14407218 GCAGGCAGTGCAGCAGGTAGAGG - Exonic
1163122799 19:15228029-15228051 GCAGCCAGGGCAGCTGGAACAGG + Exonic
1163146250 19:15380615-15380637 GCGGGCAGGGCAGAAGGAGCTGG + Intronic
1163173342 19:15548259-15548281 GGAGGCAGTGCACCAGCAGCAGG - Intronic
1163292167 19:16385985-16386007 CCAGGAAGGGGAGCAGCAGCGGG + Intronic
1163666592 19:18606572-18606594 GGACGCAGAGCAGCAGCAGCAGG + Exonic
1164130197 19:22354882-22354904 GCAGGAATGGCAGCAGCAACTGG - Intergenic
1164655538 19:29918467-29918489 GCAGGGAGGACAGCAGGAACCGG - Intergenic
1164821664 19:31255695-31255717 ACAGGCAGAGCAGCAGCAGAGGG + Intergenic
1165158758 19:33803681-33803703 GCAGGCAGGACACCAGCAAGGGG - Intronic
1165758563 19:38307947-38307969 GCAGGCAGGGCTGGAGTCACAGG + Intronic
1166231059 19:41426082-41426104 CCAGCCAGGCCAGCAGCAGCAGG + Exonic
1166990410 19:46689518-46689540 GCGGGCAGGGCAGACGCACCTGG + Exonic
1167364261 19:49046744-49046766 GCAGGAGAGGGAGCAGCAACCGG + Intergenic
1168145905 19:54420179-54420201 CCCGGCAGGGCAGCACCCACAGG + Intronic
1168459013 19:56538707-56538729 GCAGGCAGCGCCGCCGGAACCGG - Intergenic
1168553302 19:57317689-57317711 GCAGCCGGGGCAGAAGCATCGGG + Intergenic
1168712631 19:58510774-58510796 GCACGCAGGTCAGCAGGCACTGG + Exonic
925185272 2:1842628-1842650 GCAGGCAGGTCAGGAGCCAGAGG - Intronic
925194462 2:1912034-1912056 GCGGGCATGTCAACAGCAACAGG - Exonic
925327291 2:3033269-3033291 GCGGCCATGGCAGCAGCACCCGG + Intergenic
926796664 2:16625268-16625290 GCAGCAGGGGCAGCAGCAAGAGG + Intronic
926992059 2:18690534-18690556 GCAGCCAGGGTGGCAGCAAGGGG + Intergenic
927751614 2:25674579-25674601 GCAGGCAGGCAGGCAGCAGCAGG - Intergenic
927831757 2:26357596-26357618 CCAGGCAGGCCAGGAGCTACTGG - Intronic
927927236 2:27022397-27022419 GAAGGCAGAGCAGCCACAACAGG + Intronic
929821069 2:45274223-45274245 GCTGGCAGGACACCAGCATCTGG - Intergenic
929945628 2:46369610-46369632 TCAGGAAGGGCAGGAACAACAGG + Intronic
929996375 2:46828686-46828708 TCAGGCAGGGGAGCTGCACCAGG - Intronic
930014197 2:46959289-46959311 GCAGGCAGCCCAGCATCAAACGG - Intronic
934553869 2:95277419-95277441 GCAGGCCGGGCAGCAGGACCTGG + Exonic
934747843 2:96771126-96771148 GCAGGCGTGGCAGCAGACACAGG - Intronic
934769135 2:96896748-96896770 CCAGGCAGGGCACCAGCTCCAGG - Intronic
934935313 2:98461005-98461027 GCTGGCTGGGCAGCTGCAGCCGG + Intronic
935111356 2:100097368-100097390 GTAGGCAGAGCGGCAGCAATAGG - Intronic
935618306 2:105108091-105108113 GCAGGCAGGGCAGTAGCATCTGG + Intergenic
935625605 2:105169912-105169934 GCACACATGGCAGCAGCAAAGGG + Intergenic
935667421 2:105525064-105525086 GCGGGCAGGCCAGCTGCAGCAGG + Intergenic
936019687 2:108985426-108985448 GCAGGCAGGGCTACCGCCACAGG + Intronic
936123612 2:109767796-109767818 GTAGGCAGAGCGGCAGCAATAGG + Intergenic
936221074 2:110603670-110603692 GTAGGCAGAGCGGCAGCAATAGG - Intergenic
936444947 2:112587886-112587908 CCAGGGAGGGAAGCAGCAAATGG - Intronic
937203290 2:120219599-120219621 GCAGGCAGTGCTGGAGGAACTGG - Intergenic
938052707 2:128190006-128190028 GGTGGAATGGCAGCAGCAACTGG + Exonic
938118096 2:128615757-128615779 GGCAGCAGGGCAGCAGCACCAGG - Intergenic
938257334 2:129869399-129869421 CCACGCAGAGCAGCAGCCACGGG - Intergenic
939854732 2:147344669-147344691 GCAGGAACGGAAGCAACAACTGG + Intergenic
940104892 2:150088709-150088731 TCCTGCAGGGCAGCATCAACTGG + Intergenic
942122497 2:172792204-172792226 GCAGCAAGGACAGCAGCAGCTGG - Intronic
943297474 2:186156653-186156675 ACAGGCAGGTCACCAGCAAAGGG + Intergenic
944903967 2:204244218-204244240 GAAGGCTGGGCAGGAACAACCGG + Intergenic
945299917 2:208206533-208206555 ACAAGGAGGGCAGCAGAAACTGG + Intergenic
947816738 2:233042425-233042447 GCAGACTGAGCATCAGCAACGGG + Intergenic
947827336 2:233115279-233115301 GCAGGCAGAGCAGGAGCCCCGGG - Intronic
948072735 2:235140715-235140737 GCAGGACGGGGAGCAGGAACAGG - Intergenic
948118897 2:235514420-235514442 GCAGGCAGGGCCACGGCAAAGGG - Intronic
948271453 2:236676950-236676972 GCAGGCAGGGCAGGGGGAGCTGG + Intergenic
948368603 2:237474029-237474051 CCAGGTAAGGCAGCAGCACCAGG + Intergenic
948489668 2:238304398-238304420 GCAGGAAGGGCTGCTGGAACCGG - Intergenic
1168831665 20:848439-848461 GGAGACAGGGCAGCAGCTGCAGG - Intronic
1168980744 20:2001747-2001769 GCAGCCTGGGCATCAGCAAGAGG + Intergenic
1169141279 20:3228622-3228644 GCGGGACCGGCAGCAGCAACAGG + Exonic
1169223672 20:3842382-3842404 GCAAGCAGGGCACCAGAAGCTGG + Intergenic
1170843355 20:19941595-19941617 GCAGGCCGTGTAGCAGCAACAGG + Intronic
1171284602 20:23926623-23926645 GCAGGCAGGGCCACAGGAGCAGG - Intergenic
1171312116 20:24152972-24152994 GTAGGCAGTGCAGGACCAACAGG - Intergenic
1171971670 20:31568870-31568892 GCAGCAAGGGCAGCAGCCAATGG - Intronic
1172135066 20:32681286-32681308 GCAGGCAGTGGAGCTGCAACTGG + Intergenic
1172177780 20:32982955-32982977 GCTGGAATGGCAGCAGGAACTGG - Intergenic
1172793000 20:37519141-37519163 GGAGGACGGGCAGCAGCCACTGG + Exonic
1174368996 20:50073627-50073649 GCATGCAGGGCAGAGGGAACAGG + Intergenic
1174725961 20:52862324-52862346 GCCAGGATGGCAGCAGCAACGGG + Intergenic
1174782152 20:53399716-53399738 GCAGCCAGGTCAGCAGCGACTGG - Intronic
1175737501 20:61397303-61397325 GCAGGAAGGGCAGCTGCAGGAGG + Intronic
1175836068 20:61995494-61995516 ACCTGCAGGGCAGCATCAACAGG + Intronic
1176140659 20:63543319-63543341 GCATGCAGGGCTGCAGCAGGGGG + Exonic
1176299917 21:5094746-5094768 GCAGGCAGTGAAGCTGCATCAGG - Intergenic
1177782998 21:25639851-25639873 CCAGGTAGCGCAGCAGCAGCAGG - Exonic
1178594958 21:33945002-33945024 GGAGGGAGGGCAGGATCAACAGG + Intergenic
1178973379 21:37201001-37201023 GCAGTGTGGGCAGCAGCAGCAGG + Intronic
1179036425 21:37762458-37762480 GCTGGCTGGGCAGGAGCCACAGG + Intronic
1179560244 21:42211322-42211344 TCAGGGAGGGCAGCAGCATAAGG - Intronic
1179562970 21:42228429-42228451 GCAGGCAGGGGAGGAGGAGCAGG - Intronic
1179857105 21:44167165-44167187 GCAGGCAGTGAAGCTGCATCAGG + Intergenic
1179921058 21:44507844-44507866 GCAGCCATGGCAGGAGAAACAGG - Intronic
1179926826 21:44539350-44539372 GGAGGCCGGGCGGCAGCAGCTGG + Exonic
1179929527 21:44558137-44558159 GGAGGCCGGGCGGCAGCAGCTGG + Exonic
1179931680 21:44574924-44574946 GGAGGCTGGGCGGCAGCAGCTGG - Exonic
1179932540 21:44579811-44579833 GGAGGCCGGGCGGCAGCAGCTGG + Exonic
1179934079 21:44591423-44591445 GCAGGCAGGGCGGGAGCACATGG + Exonic
1179935546 21:44601631-44601653 GGAGGCTGGGCGGCAGCAGCTGG - Exonic
1179940806 21:44638115-44638137 GCAGGCAGGGCGGGAGCACACGG - Exonic
1179942149 21:44647252-44647274 GGAGGCCGGGCGGCAGCAGCTGG - Exonic
1180189636 21:46156417-46156439 GTAGTCAGGGGAGCAGCAGCTGG - Intergenic
1180229532 21:46418700-46418722 GCAGGCAAGGCAGCAGAGCCTGG - Intronic
1181500985 22:23315435-23315457 GCAGGAAGTACAGCAGCACCTGG - Exonic
1182146596 22:28000587-28000609 GCAGGCAGGGATGCTGCAAGTGG + Intronic
1184297717 22:43535863-43535885 GCACACAGGGAAGCAGCAGCAGG + Intronic
1184331184 22:43828956-43828978 GCAGGGAGGGCAACAGGGACCGG + Intronic
1184683717 22:46086451-46086473 GCCAGCAGGGCAGGAGCAGCGGG + Intronic
1184920949 22:47605580-47605602 GGATGCAGGGCTGCAGCAGCCGG - Intergenic
1185252806 22:49814265-49814287 ACAGGCAGGGCAGGAGCCCCCGG + Intronic
1185311795 22:50160185-50160207 GGAGGAAGGGCAGCAGAAAGGGG - Intronic
949723956 3:7022739-7022761 ATAGCCAGGGCAGCAGAAACAGG + Intronic
950273172 3:11635450-11635472 GCAGGCAGGGAAGCAACATGTGG + Intronic
950424209 3:12915851-12915873 CCAGGCAGGCCCACAGCAACAGG + Intronic
950496701 3:13338149-13338171 TCAGACAGGGCAGCAGCCTCAGG - Intronic
950567731 3:13780938-13780960 GCAGGGGGGCCTGCAGCAACAGG + Intergenic
950582867 3:13874031-13874053 GCAGGATGGCCAGGAGCAACAGG + Intronic
950887443 3:16374066-16374088 GCAAGCATGACAGCAGCCACAGG + Intronic
951541146 3:23783258-23783280 GCAAGCAGGGGAGCAGGCACTGG + Intergenic
953447522 3:42980465-42980487 GCAGGCACGGAAGCAGCCAGGGG - Intronic
953535161 3:43771542-43771564 GCAGGCAGGGGGGCAGCAGGGGG + Intergenic
953822754 3:46222406-46222428 AGAGGCAAGGCAGCAGCAAGAGG - Intronic
954030878 3:47819069-47819091 GTAGTCAGGGCCGCAGCAGCAGG - Intronic
954413474 3:50381374-50381396 GCAGGCAGGGCAGCTGTGGCTGG + Intronic
954660741 3:52225566-52225588 GCAGACTGGACAGCAGCTACAGG + Exonic
954955845 3:54517786-54517808 GGAGGCAGGGTTGGAGCAACAGG - Intronic
955387769 3:58492514-58492536 GCTGGCGGGGCAGCAGCGAAGGG + Intronic
960701860 3:120447351-120447373 GCAGAGAGGGCAGCAGCAGAGGG - Intronic
960962558 3:123082590-123082612 TCAGGCAGGGCAGCAGGTCCAGG - Intronic
961036335 3:123644576-123644598 GCAGGGAGGGCAGGAGTCACAGG - Intronic
961077041 3:123992048-123992070 GCGGGGAGGGCAGCAGCGGCCGG + Intronic
961107937 3:124258091-124258113 GCAGGCTGGGGAGCAGCTGCGGG + Intronic
961117894 3:124347465-124347487 GAAGGCAGCCCAGCAGCCACAGG - Intronic
961307535 3:125969252-125969274 GCGGGGAGGGCAGCAGCGGCCGG - Exonic
961641865 3:128369858-128369880 GCAGGCACAGCAGCAGCACCAGG - Intronic
961737372 3:129010608-129010630 TCAGGCCAGGCAGCAGCAATGGG - Intronic
961815376 3:129547491-129547513 GCAGGCTGGGGAGCAGCGCCGGG + Exonic
962101825 3:132350800-132350822 GAAGGCAGGGCAGGAGTGACAGG + Intronic
962201132 3:133401958-133401980 GCAAGCAGAACAGCAGCACCAGG - Intronic
962210397 3:133472458-133472480 GGAGGCGGAGCAGCAGCAACAGG + Exonic
962920956 3:139950049-139950071 GGAGGCAGGGCAGCAGGAAGAGG + Intronic
963858440 3:150280717-150280739 GCAGGAAGGGGAGCTGCAAAGGG - Intergenic
964076971 3:152703683-152703705 GCAGGAAGAGCAGCAGCTTCTGG + Intergenic
965384489 3:168029853-168029875 GCAGGAACAGCAGCAGCAGCAGG - Exonic
965820030 3:172676038-172676060 GCATGCAGGGGAGCAGCAGTTGG - Intronic
966904625 3:184513405-184513427 TCAGGCACGGCAGCAGCATTGGG + Intronic
967411849 3:189174188-189174210 GCTTGCAGAGCAGCAGCCACAGG + Intronic
968472544 4:788646-788668 GCGGGAAGGGCAGCAGCTCCAGG + Intronic
968488391 4:876326-876348 GGGGGCAGAGCAGCAGCCACCGG + Intronic
968601049 4:1509482-1509504 GCAGGCAGGGCACAGGCATCAGG + Intergenic
968726516 4:2250403-2250425 CCAGGCAGCCCAGCAGCAGCTGG + Exonic
968862711 4:3185207-3185229 GCACTGAGGGCAGAAGCAACAGG + Intronic
969197699 4:5576385-5576407 GGAGGCAGCCCAGCAGCAGCAGG - Exonic
969230323 4:5826243-5826265 CCAGACAAGGCAGCAGCAACGGG + Intronic
969260044 4:6027628-6027650 GCATGCAGAGCAGGAGGAACTGG - Intronic
969531954 4:7735166-7735188 GCAGGCAGGGGAGAAACAATAGG - Intronic
970674199 4:18430219-18430241 TGAGTTAGGGCAGCAGCAACAGG + Intergenic
972583843 4:40419026-40419048 GCAGGCAGGGCAGCATGTGCAGG + Intergenic
972767974 4:42169271-42169293 GCAGTCAAGGCCGTAGCAACTGG + Intergenic
973292530 4:48484008-48484030 GCAGGAAGGCCAGCAGCGGCAGG - Exonic
975128767 4:70811536-70811558 GCAGACATGCCAGCAGCAACGGG + Intergenic
976974888 4:91154158-91154180 GCAGCCAGGGAAGCTTCAACTGG - Intronic
977020250 4:91749799-91749821 GAAGGCAGGGCAGACTCAACTGG + Intergenic
979595646 4:122531411-122531433 GAAGGCAGTGTAGCAGGAACAGG - Intergenic
979595703 4:122531925-122531947 GAAGGCAGTGTAGCAGGAACAGG + Intergenic
979916039 4:126434870-126434892 GCAGGGAGGGCAGAGGCAATAGG + Intergenic
981361808 4:143854717-143854739 GCAGGCAGGGAAGGAGCAGTTGG + Intergenic
981381634 4:144078822-144078844 GCAGGCAGGGAAGGAGCAGTTGG + Intergenic
981422079 4:144562595-144562617 TCAGGTAGGGCATCTGCAACAGG + Intergenic
981823617 4:148914520-148914542 GCAGCCAGGACTGCAGCAACAGG + Intergenic
985669840 5:1201601-1201623 GCAGGCAGGGCAGAAGCTGGAGG - Exonic
985781033 5:1872014-1872036 CCAGCCAGGGCAGCTGCAGCAGG - Intergenic
986174902 5:5343697-5343719 GCAGGCAGTGCAGCTGTAAAAGG - Intergenic
988997161 5:36725499-36725521 GCAGGCATGGCATCAGGAAGAGG + Intergenic
989229908 5:39074204-39074226 GGAGCCAGGGCAGCCGCAGCTGG - Intronic
990210935 5:53480830-53480852 ACTGGCAGAGCAGCAGCAGCAGG - Exonic
990618873 5:57538563-57538585 GCCTGCAGAGCTGCAGCAACTGG - Intergenic
991017367 5:61946188-61946210 GCAGGCAGGCAGGCAGCAGCCGG - Intergenic
993499961 5:88654492-88654514 CAAAGCAGGGCAGCATCAACAGG + Intergenic
994089018 5:95792102-95792124 GCAGGCAGGGCAGCAGCAACAGG + Intronic
994559275 5:101346799-101346821 GAAGGCAGGTCACCCGCAACTGG - Intergenic
995581541 5:113607674-113607696 GCAGGAAGGGCCACAGCATCTGG - Intergenic
996760233 5:126979551-126979573 GGGGGCAGGGCAGCTGCATCAGG + Intronic
997212664 5:132086596-132086618 GAGGCCAGGGAAGCAGCAACTGG + Intergenic
997266170 5:132496503-132496525 GCAGCCGGGTCAGCAGCTACAGG + Intergenic
997293330 5:132753372-132753394 GCAGGTAGAGCAGCAAGAACTGG - Exonic
997355514 5:133260278-133260300 GCAGGGAGGGGAGAAGCCACTGG + Intronic
997672341 5:135685826-135685848 GAAGGCAGAACAGCTGCAACTGG - Intergenic
998494566 5:142576483-142576505 GCAGGCAGAAAAGCAGCAATAGG - Intergenic
1000563075 5:162814440-162814462 GCAGGGAGGGTACAAGCAACAGG - Intergenic
1002064378 5:176644777-176644799 CCAGGCAGGGCAGAAGTCACTGG - Intronic
1002313751 5:178330160-178330182 GCAGGGAGGGCAGCAGTCCCAGG - Intronic
1002612791 5:180432339-180432361 GCAGGCAGGCCAGCAGCGTTGGG - Intergenic
1002921998 6:1579640-1579662 ACAGGCAGGCCAGCAACCACGGG - Intergenic
1003247989 6:4400392-4400414 GCAGGCCAAGCAGCATCAACTGG - Intergenic
1005424051 6:25682730-25682752 GTAAGCAGGGCAGCAGTTACAGG + Intronic
1005854520 6:29850598-29850620 ACAGGCACTGCAGCAGCGACAGG - Intergenic
1006300155 6:33189647-33189669 GGAGGCAGGGCAGCATCAGCTGG + Intronic
1006572496 6:35017476-35017498 ACAGGCGGAGCAGCAGCAGCCGG + Exonic
1007323622 6:41044020-41044042 CTAGGTAGGGCAGCAGTAACAGG - Exonic
1007603194 6:43096666-43096688 ACACCCAGGGCAGCAGCAAAAGG - Intronic
1007686609 6:43670823-43670845 GCAGGCTGCGCAGCACCACCAGG - Exonic
1007787578 6:44289968-44289990 GCAGGCTGGGAAGCACCATCTGG - Intronic
1009290724 6:61878182-61878204 CTATGCAGGGCAGCAGGAACTGG - Intronic
1010545189 6:77145751-77145773 ACTGGCAGGGCAGCAGGAAGAGG + Intergenic
1011848012 6:91590426-91590448 GCAGGCAGGGAAGCTTGAACTGG + Intergenic
1012926712 6:105274800-105274822 GCAGGCAGGGCAGTAACCCCAGG - Intergenic
1014418635 6:121214470-121214492 CCAGGCAGGCCAGCTGCAGCAGG + Intronic
1016393430 6:143597872-143597894 TCAGGAAGGGCACCAGCAATGGG - Intronic
1016916232 6:149247009-149247031 GAGGGCAGAGCAGCAGCAAAAGG - Intronic
1018573295 6:165233182-165233204 ACAGACAGGGCAGCAGACACAGG + Intergenic
1018877565 6:167838360-167838382 TCAGGCAAGGCAGCACCAAGAGG - Intronic
1019004551 6:168785274-168785296 GCAGACAGGGCAGCACCGTCTGG - Intergenic
1019497719 7:1348153-1348175 GCAGGCAGGGCTGCCCCAGCTGG + Intergenic
1019630045 7:2044109-2044131 GCAGGAAGGGGAGCAGCCAACGG + Intronic
1019702091 7:2478922-2478944 GCTGGCTGGGCACCAGCCACTGG + Intergenic
1020641824 7:10764377-10764399 GCAGACAGTGCAGCAGCAGTAGG + Intergenic
1021641035 7:22736089-22736111 GCAGGGTGGGCAGTAGCTACAGG + Intergenic
1022100111 7:27164476-27164498 GCAGCCAGGGCAGCCGGAGCTGG - Intronic
1022185253 7:27960973-27960995 GCAGGCAGTGCAGAAGCAAATGG + Intronic
1022728008 7:32998165-32998187 GGAGGCAGGGCAGCAGGGAAGGG + Intronic
1023080548 7:36522359-36522381 GCAGGGAGGGCAGTAGGAAAAGG + Intronic
1024059119 7:45685319-45685341 ACAGACAGGGCAGGAGGAACAGG + Intronic
1024983954 7:55180069-55180091 CCGGGCAGGTCAGGAGCAACAGG - Intronic
1025045645 7:55689854-55689876 GGAGGCAGGGCAGCAGGGAAGGG - Intergenic
1025818542 7:64942723-64942745 GCAGGAACCGCAGCAGCAGCCGG + Intergenic
1026877390 7:73887370-73887392 CCAGGCAGGGCAGCAGGACTGGG - Intergenic
1026901491 7:74039869-74039891 GGAGGCTGGGTAGCAGCAGCAGG + Intronic
1026950653 7:74344258-74344280 GCAGGGTTGGCAGCAGCAAGGGG + Intronic
1026993418 7:74600806-74600828 GCAGGCAGGCCAGCAAGAGCAGG + Intronic
1028659532 7:93253604-93253626 GAAGGCAGAGCAGCAGCAGTGGG + Intronic
1028890342 7:95980205-95980227 GCATACAGTGCAGCAGGAACAGG - Intronic
1028921277 7:96313218-96313240 GCAGGTAGTGCGGCAGGAACTGG + Intronic
1029270172 7:99372895-99372917 GAAGCCAGGGAAGCAGCAACAGG + Intronic
1029478360 7:100798635-100798657 GCAGGGAGGGCAGAAGGAACAGG + Intergenic
1031198318 7:118644835-118644857 GCAGGAAGGGCAGGAACACCAGG + Intergenic
1031820674 7:126497544-126497566 CCAGGCAGGGCAGTTCCAACTGG - Intronic
1032267514 7:130379760-130379782 CCAGCCCGGGCAGCAGCAGCAGG - Intergenic
1032620075 7:133520707-133520729 GAAGGTAGGGCTTCAGCAACTGG - Intronic
1034402231 7:150870165-150870187 ACAGCCAGGCCAGCAGCTACAGG - Intergenic
1035220890 7:157406012-157406034 GTAGCCAGGGCAGCTGCAGCAGG + Intronic
1035277614 7:157757472-157757494 GCGGGCAGGGCCGGGGCAACTGG + Intronic
1035731185 8:1854360-1854382 GCAGGCAGGGGTGCAGCCTCAGG + Intronic
1036165645 8:6430168-6430190 CCAGGCAGAAAAGCAGCAACAGG - Intronic
1037143059 8:15540517-15540539 GGATGCAGAGCAGCAGCAGCAGG - Exonic
1037362657 8:18090229-18090251 GCATGCATGCCAGCAGCAATGGG - Intergenic
1037809791 8:22080647-22080669 ACAGGCAGAGCAGCAGAAGCTGG + Intronic
1038281109 8:26165821-26165843 CCAGGCAGTGCAGCAGGAACTGG - Intergenic
1038331347 8:26611881-26611903 CCAGGCCAGGCAGCAGCAGCAGG - Intronic
1038537621 8:28365103-28365125 CCAGGCTGGGCAGCATCACCAGG + Intronic
1038992135 8:32879177-32879199 GCAGGCAGGGCAGCTGCCCAGGG - Intergenic
1039374594 8:37020570-37020592 GCAGGCGGGGCTGTGGCAACTGG + Intergenic
1039672084 8:39612781-39612803 GGAGCTATGGCAGCAGCAACAGG - Intronic
1039672127 8:39613056-39613078 GCATGCATGGCAGCAGCAACAGG - Intronic
1039753444 8:40497950-40497972 GCAGACGTGGCAGCCGCAACAGG - Intergenic
1041047122 8:53898116-53898138 GGAGGCAGAGCAGCAGCTCCTGG - Intronic
1041095378 8:54344161-54344183 GCTGGCAGGGGAGGAGCATCTGG - Intergenic
1042541101 8:69907718-69907740 GCAGCCAGGGAAGCTCCAACTGG + Intergenic
1042857904 8:73285916-73285938 GCAGGCAGCGCTGCAGCCTCGGG - Intergenic
1043211626 8:77526725-77526747 TCAGGCATGGCAGCATCAAGGGG + Intergenic
1043382969 8:79722703-79722725 GCAAGCAGGCCAGTAGCATCTGG + Intergenic
1043517829 8:81012526-81012548 CCAGCCAGGGAAGCAGCAAAAGG - Intronic
1044873835 8:96645265-96645287 GCAAGCAGGGCTGCAGTCACGGG + Exonic
1047175103 8:122533235-122533257 GAAGGCAAAGCAGCAGCTACAGG - Intergenic
1048236266 8:132693769-132693791 GCAGACAGGGGAGCAGCAAATGG + Intronic
1048418109 8:134249652-134249674 TCAGCAGGGGCAGCAGCAACAGG - Intergenic
1048645429 8:136414326-136414348 GCATGCAGGCCATAAGCAACTGG - Intergenic
1049001422 8:139827681-139827703 CCAGCCAGGACAGCAGCAAGAGG + Intronic
1049427173 8:142542684-142542706 GAGGGCAGGGCTGCAGCAGCTGG + Intronic
1049431374 8:142566849-142566871 GCTGCCAGGGCAGCAGCGCCAGG - Intergenic
1049544810 8:143225696-143225718 GAAGGCAGCGCAGAAGCAACTGG + Intergenic
1049573101 8:143378675-143378697 GCCTGCAGGGCAGGAGCCACTGG - Exonic
1049743422 8:144251955-144251977 GAAGGATGGGCAGCAGCACCCGG - Intronic
1049808146 8:144550655-144550677 GAAGTCAGGGCAGCAGCCAGGGG + Intronic
1050119865 9:2297176-2297198 GCATGAATGGGAGCAGCAACAGG + Intergenic
1050424353 9:5498621-5498643 GCAGGCAGGTCATGAGCAGCTGG - Intergenic
1052122800 9:24738711-24738733 GCAGGCAGGCCGGCAGCAATGGG - Intergenic
1053141926 9:35688013-35688035 GGAGGCAGAGCCGCAGCACCAGG - Intronic
1055240783 9:74183360-74183382 GCAGGAAGGGGAGCAGAAAAGGG + Intergenic
1055266068 9:74497551-74497573 GGAGGAAGGGCAGCAGCAGGAGG - Exonic
1056183517 9:84108696-84108718 GCAGAAAGAGCAGAAGCAACAGG + Intergenic
1057152450 9:92807930-92807952 GCTGGCACCGCTGCAGCAACCGG - Intergenic
1057294637 9:93827967-93827989 GCAGGCCGGGCTTCAGCAAATGG + Intergenic
1059326390 9:113506401-113506423 ACGGGCAGGGCTGCAGCAGCTGG + Exonic
1059348072 9:113645773-113645795 CCAGGGAGGGCAGCGGCGACAGG + Intergenic
1059929710 9:119248941-119248963 GGAGGTAGGTCAGCAGCCACTGG - Exonic
1060267781 9:122122236-122122258 GAAGCCAGGGCAGGAGCAAGAGG - Intergenic
1061518954 9:131106130-131106152 GGAGGCAGGGCCCCAGCCACAGG - Intronic
1061859551 9:133460831-133460853 GCGGCTAAGGCAGCAGCAACGGG - Intronic
1062121091 9:134834420-134834442 GCAGGGAGAGCAGCTGCAGCTGG + Intronic
1062264827 9:135682133-135682155 GGAGGCAGGGTGGCAGCCACTGG - Intergenic
1062280839 9:135750970-135750992 GCAGGCAGGTGAGCAGCTTCAGG - Exonic
1185604177 X:1358169-1358191 GCAGGCATAGCTGCAGCCACAGG + Intronic
1187067247 X:15853866-15853888 GCAGGAAGTGAAGCATCAACTGG + Intronic
1187877660 X:23817358-23817380 GCAGGCAGGGCAGCGGGAGCTGG - Intergenic
1188338773 X:28972958-28972980 GCAGGAAGGGCATGACCAACAGG - Intronic
1189647810 X:43153354-43153376 GCCAGCAGGGTAGCAGCAATTGG - Intergenic
1190406568 X:50093864-50093886 GGAGGCATGGCAGCAGCAACTGG - Exonic
1191682292 X:63853493-63853515 GCAGGCTGGGGAGCAGCAGATGG - Intergenic
1192224556 X:69219332-69219354 GCAGGCAGAGCAGCTGCTTCTGG - Intergenic
1192593988 X:72387290-72387312 GCAGGGAGAGGAGCAGCCACTGG - Intronic
1194511486 X:94801291-94801313 GGAGACAGGGCAGCAGAAGCAGG + Intergenic
1194977763 X:100410507-100410529 GCAGGCCAGGCAGGAGCAATAGG + Intergenic
1195668310 X:107449797-107449819 GTTGGCAGGGCGGCAGCAGCTGG - Intergenic
1196189435 X:112779476-112779498 GCAGTGGCGGCAGCAGCAACTGG + Exonic
1196256314 X:113523067-113523089 GCAGGCAGGGAAGCAAACACAGG - Intergenic
1197345958 X:125326136-125326158 GCTTGCAAGGCAGCAGCACCAGG - Intergenic
1199362154 X:146933916-146933938 GTAGGAAGGGCAGGAGGAACGGG - Intergenic
1199499896 X:148497900-148497922 GCATGGAGGGCAGTAGCAAGAGG - Intergenic
1199712233 X:150477540-150477562 GCAGCCAAGGCAGCAGACACAGG + Intronic
1200244826 X:154517346-154517368 GCCGGCAGGGCAGAAGGGACGGG - Intergenic
1200289384 X:154857390-154857412 GAAGGCAGGGTAGCAGAAACAGG - Intronic
1201784188 Y:17756571-17756593 ACAGGCAGGGCAGACGCAACTGG + Intergenic
1201817365 Y:18149416-18149438 ACAGGCAGGGCAGACGCAACTGG - Intergenic