ID: 994097352

View in Genome Browser
Species Human (GRCh38)
Location 5:95858954-95858976
Sequence GTTGATGAGCAGTCGGGAAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 127}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994097341_994097352 7 Left 994097341 5:95858924-95858946 CCGGCTTGCCTCTCGGCCCCAGG 0: 1
1: 0
2: 1
3: 28
4: 247
Right 994097352 5:95858954-95858976 GTTGATGAGCAGTCGGGAAGTGG 0: 1
1: 0
2: 0
3: 5
4: 127
994097337_994097352 18 Left 994097337 5:95858913-95858935 CCCGCGCGGACCCGGCTTGCCTC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 994097352 5:95858954-95858976 GTTGATGAGCAGTCGGGAAGTGG 0: 1
1: 0
2: 0
3: 5
4: 127
994097345_994097352 -1 Left 994097345 5:95858932-95858954 CCTCTCGGCCCCAGGGAGGTCGG 0: 1
1: 0
2: 1
3: 7
4: 141
Right 994097352 5:95858954-95858976 GTTGATGAGCAGTCGGGAAGTGG 0: 1
1: 0
2: 0
3: 5
4: 127
994097340_994097352 8 Left 994097340 5:95858923-95858945 CCCGGCTTGCCTCTCGGCCCCAG 0: 1
1: 0
2: 1
3: 21
4: 277
Right 994097352 5:95858954-95858976 GTTGATGAGCAGTCGGGAAGTGG 0: 1
1: 0
2: 0
3: 5
4: 127
994097347_994097352 -9 Left 994097347 5:95858940-95858962 CCCCAGGGAGGTCGGTTGATGAG 0: 1
1: 0
2: 0
3: 1
4: 94
Right 994097352 5:95858954-95858976 GTTGATGAGCAGTCGGGAAGTGG 0: 1
1: 0
2: 0
3: 5
4: 127
994097338_994097352 17 Left 994097338 5:95858914-95858936 CCGCGCGGACCCGGCTTGCCTCT 0: 1
1: 0
2: 0
3: 7
4: 55
Right 994097352 5:95858954-95858976 GTTGATGAGCAGTCGGGAAGTGG 0: 1
1: 0
2: 0
3: 5
4: 127
994097336_994097352 19 Left 994097336 5:95858912-95858934 CCCCGCGCGGACCCGGCTTGCCT 0: 1
1: 0
2: 0
3: 9
4: 70
Right 994097352 5:95858954-95858976 GTTGATGAGCAGTCGGGAAGTGG 0: 1
1: 0
2: 0
3: 5
4: 127
994097348_994097352 -10 Left 994097348 5:95858941-95858963 CCCAGGGAGGTCGGTTGATGAGC 0: 1
1: 0
2: 0
3: 6
4: 77
Right 994097352 5:95858954-95858976 GTTGATGAGCAGTCGGGAAGTGG 0: 1
1: 0
2: 0
3: 5
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994097352 Original CRISPR GTTGATGAGCAGTCGGGAAG TGG Exonic
902940605 1:19798169-19798191 GCTGATGAGGAGTGGGGAACTGG - Exonic
907516612 1:54997121-54997143 GGTGATGAGCAGTCGCGGCGGGG - Intergenic
911593023 1:99769193-99769215 GTTGATGAAGAGTCTGGTAGAGG - Intergenic
920932742 1:210404228-210404250 GTTAATGAGCAGTAGGAAAAAGG - Intronic
921035474 1:211374274-211374296 GCATATGAGCAGTAGGGAAGTGG - Exonic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
923212084 1:231812622-231812644 GTTGAAGAGCAGGCGGGCACAGG + Intronic
1062923893 10:1299931-1299953 GTTGATGGCCAGGCGTGAAGTGG - Intronic
1064109159 10:12523220-12523242 GATGATGGGCGGCCGGGAAGAGG + Intronic
1065484215 10:26221629-26221651 GCTCATGATCAGTTGGGAAGAGG - Intronic
1067128900 10:43543874-43543896 GATGATGGGCAGCCGGGCAGAGG - Intergenic
1067128909 10:43543913-43543935 GATGATGGGCAGCCGGGCAGAGG - Intergenic
1067375227 10:45721661-45721683 GTTGATGGGGAGTAGGGGAGGGG - Intergenic
1071099147 10:82014645-82014667 GTTGATGAACATTTGGGATGAGG + Intronic
1074494247 10:113965104-113965126 GCTGATGAGCTGTGGGGAGGTGG + Intergenic
1076164098 10:128268259-128268281 GCTGCAGAGCAGGCGGGAAGAGG + Intergenic
1077065873 11:640730-640752 GCTGATGGGGAGTGGGGAAGAGG + Intergenic
1084989551 11:72909905-72909927 GATGATGGGCAGCCGGGCAGAGG - Intronic
1085207362 11:74744040-74744062 GTGGATGAGGAGTGAGGAAGGGG + Intergenic
1086583555 11:88426398-88426420 GTTGATGATGATTCTGGAAGAGG - Intergenic
1087329805 11:96766532-96766554 GTTGAGGAGGAGTTGGGAAAAGG - Intergenic
1092760640 12:11807981-11808003 GCTGATGATCATTGGGGAAGGGG - Intronic
1094689751 12:32756917-32756939 TTTAATGAGCAGTCAGTAAGAGG - Intergenic
1095330150 12:40950474-40950496 TTTGATGAGCAGTGGAAAAGAGG + Intronic
1100825689 12:98472331-98472353 GTTGGAGAGCACTGGGGAAGGGG - Intergenic
1102504040 12:113372635-113372657 GTAGATGAGCTGTGGGGTAGGGG - Exonic
1106690984 13:32116260-32116282 GTTGATGAGCAGTGATAAAGTGG - Intronic
1109731247 13:66417172-66417194 GTTGATGGGTAGTGGGTAAGGGG - Intronic
1110641306 13:77827911-77827933 GCTGATGAGAAGAAGGGAAGTGG + Intergenic
1111109945 13:83693965-83693987 GTTGATGAGAGATGGGGAAGTGG + Intergenic
1112421335 13:99252114-99252136 CTGGATGACCAGTTGGGAAGTGG - Intronic
1114316226 14:21512125-21512147 GTTGACGAGGCGTGGGGAAGTGG + Intergenic
1114975090 14:28085937-28085959 ATGGATGAGGAGTTGGGAAGTGG - Intergenic
1117133369 14:52707547-52707569 GTAGAGGAGGAGTGGGGAAGTGG + Intronic
1118034108 14:61848441-61848463 TGTGCTGAGCAGTCTGGAAGTGG + Intergenic
1118749075 14:68793649-68793671 GTCGAAGAGAAGTCGGGAAAAGG - Intronic
1122034504 14:98937542-98937564 GGTGATGAGGAGTGGGGGAGGGG - Intergenic
1125031999 15:35082726-35082748 GATGATGGGCAGCCGGGCAGAGG - Intergenic
1128622272 15:69160783-69160805 GCTGAGGAGCGGTCGGGGAGCGG + Intronic
1129653597 15:77508251-77508273 GGTGCTGAGTAGGCGGGAAGGGG - Intergenic
1138455262 16:57117275-57117297 GGAGATGAGGAGTCAGGAAGCGG - Intronic
1145938140 17:28726814-28726836 GTTTAAGAGCCGGCGGGAAGAGG - Intronic
1147841471 17:43374889-43374911 GGGGATGGGCAGTGGGGAAGTGG + Intergenic
1149817819 17:59743930-59743952 GTTGAAGAGGAGTCATGAAGGGG + Intronic
1150380562 17:64716507-64716529 GACGATGGGCAGCCGGGAAGAGG - Intergenic
1152717384 17:81906557-81906579 GTTAAGAAGCAGTCGGGATGGGG + Intronic
1152829179 17:82486629-82486651 GCTGAGGAGCAGCCGGGAGGTGG + Intronic
1153001279 18:457603-457625 TTTGATGAGCAGTTGCGAAATGG + Intronic
1153483664 18:5573548-5573570 GTAGATCATCAGTGGGGAAGAGG + Intronic
1156121196 18:33845066-33845088 GTTGATGAGTGGTGGGGAGGTGG - Intergenic
1156310607 18:35918669-35918691 GTTGATGTCCTGTGGGGAAGGGG + Intergenic
1156407711 18:36798512-36798534 GGTGATGAGCAGGCGGTAATAGG + Exonic
1156449387 18:37258535-37258557 ATTGTTGAGGAGTCAGGAAGAGG - Intronic
1156715771 18:40008115-40008137 GCTGTTGAGCAGTCGAGTAGTGG + Intergenic
1164016594 19:21260259-21260281 GATGATGGGCAGCCGGGCAGTGG + Intronic
1165856244 19:38880703-38880725 GTTGATGAGCAGGCGAGGGGTGG + Exonic
925355741 2:3239761-3239783 GTTAATGAGCAGCCAGGAAGGGG - Intronic
927628016 2:24744506-24744528 ATTGATCAGCAGTCTGGTAGAGG + Intronic
932841678 2:75088874-75088896 GCAGATGAGCTGTGGGGAAGAGG - Intronic
934712140 2:96523164-96523186 GTTGAGGAGCTGCCTGGAAGTGG - Intergenic
935349296 2:102140027-102140049 GTTGACCAGCAGGTGGGAAGGGG - Intronic
936249973 2:110860788-110860810 GTAGAAGAGCACTCAGGAAGTGG + Intronic
937239197 2:120449466-120449488 GTTGGTGAGCAGTGGGGAATGGG - Intergenic
938025291 2:127942390-127942412 GTAGATGATCAGAAGGGAAGGGG + Intronic
938878012 2:135554182-135554204 GTTGCTGAGGACTGGGGAAGAGG - Intronic
941228939 2:162884655-162884677 GCTGATGAGAAGTGAGGAAGTGG + Intergenic
944839882 2:203614752-203614774 GGTGATGAGAAGTGAGGAAGTGG + Intergenic
947581066 2:231318949-231318971 TTTGAAGAGCAGTGGGGCAGAGG + Intronic
948414152 2:237789566-237789588 GTGGATCAGGAGTCTGGAAGTGG + Intronic
1169023331 20:2347247-2347269 GTGGAAGAGGAGTGGGGAAGGGG - Intergenic
1170332356 20:15227545-15227567 GTTTAGAAGCAGTGGGGAAGGGG + Intronic
1170740459 20:19051489-19051511 GTTGTTGGGCAGTGGGGGAGGGG + Intergenic
1172013321 20:31858970-31858992 ACTGATGAGCAGTCGGTAAGTGG - Intronic
1175185630 20:57178197-57178219 GATGCTGAGCAGTGGGGACGAGG + Intronic
1179815967 21:43906550-43906572 GTTGATGAGGAGGTGGGATGGGG + Intronic
1181369569 22:22405319-22405341 GGTGATGAGCAGTTTGCAAGGGG - Intergenic
1182518467 22:30871983-30872005 GTTTCCCAGCAGTCGGGAAGGGG - Intronic
950812489 3:15662634-15662656 GTTGAAAAGCAGTGGTGAAGGGG + Intergenic
954438819 3:50510523-50510545 GTTGATGAGCAGAAGCCAAGAGG - Intergenic
957217585 3:77341524-77341546 GTTGATGGGAACTGGGGAAGTGG + Intronic
962398366 3:135036882-135036904 CTTGATGAGCAGTCCTGATGTGG + Intronic
963209431 3:142672929-142672951 GTTGCAGAGCCTTCGGGAAGAGG - Intronic
964485181 3:157179043-157179065 GATGATGGGCAGCCGGGCAGAGG + Intergenic
966907478 3:184538432-184538454 ATTGATGAGCCTTCGAGAAGAGG + Intronic
970053304 4:11941208-11941230 GAGGATTAGCAGTGGGGAAGGGG - Intergenic
971803252 4:31319614-31319636 GTTAATCAGCAGTGGGGATGGGG + Intergenic
973574568 4:52273829-52273851 GGTGATGAGCAGTAGGGCATGGG - Intergenic
976976155 4:91168239-91168261 GATGATGGGCAGCCGGGCAGAGG - Intronic
976976241 4:91168540-91168562 GATGATGGGCAGCCGGGCAGAGG - Intronic
978868741 4:113548486-113548508 GTAGATGAGCAAACTGGAAGAGG + Intronic
982068410 4:151674139-151674161 TTTCCTGAGCAGTCGGGCAGCGG - Intronic
986824675 5:11507563-11507585 GCTGCTGAGAAGTCTGGAAGGGG + Intronic
987256979 5:16165110-16165132 TTTGAAGAGCATTCTGGAAGGGG - Intronic
990941240 5:61205159-61205181 GATGGTGGGCAGTCGGGCAGAGG - Intergenic
993167489 5:84375761-84375783 GAAGATGAGCACTTGGGAAGTGG - Intronic
993504056 5:88690564-88690586 TTTGATGAGAAATGGGGAAGGGG - Intergenic
994097352 5:95858954-95858976 GTTGATGAGCAGTCGGGAAGTGG + Exonic
994143896 5:96371400-96371422 GTTGATGAGGAATGGGGCAGAGG + Intergenic
1003508555 6:6760093-6760115 GATGATGAGCAGTGAGGAGGAGG - Intergenic
1004450727 6:15743280-15743302 GTTGAGGACTAGTTGGGAAGAGG - Intergenic
1007970612 6:46048603-46048625 GTTGATGAGGAGGTGGGAGGTGG - Intronic
1008620640 6:53268187-53268209 GTAGATGAGCAATGGGGAACTGG - Exonic
1011509664 6:88086707-88086729 GTTGATGAGAAATGGGGAAGAGG - Intergenic
1015240573 6:131018596-131018618 GTTGATGAGTTGGCGGGGAGGGG - Intronic
1015839803 6:137465236-137465258 GTTGTTGAGCAGTCCGTAAGTGG + Intergenic
1016878555 6:148887756-148887778 GTTGATCAGTACTTGGGAAGGGG + Intronic
1023701610 7:42897202-42897224 GTTGAAGAGGAGTGGTGAAGTGG - Intergenic
1024063460 7:45715428-45715450 GTTGAGGAGCAGTGAGGAGGCGG - Exonic
1029052208 7:97700802-97700824 GGTGATGAGCAGTGGGGGACTGG - Intergenic
1030415128 7:109233822-109233844 GTTGATAAGCAATAGGCAAGGGG - Intergenic
1034478725 7:151303680-151303702 GCTGAGCAGCAGCCGGGAAGGGG + Intergenic
1034993892 7:155566140-155566162 GTTGATGAGCAGCCGAGGCGAGG + Intergenic
1039391635 8:37185596-37185618 GTTGAAGAGCCCTGGGGAAGAGG - Intergenic
1039662626 8:39483553-39483575 TCTGATGAGCAGTCCAGAAGAGG - Intergenic
1040480247 8:47819047-47819069 GGTCCTGAGCAGTGGGGAAGAGG - Intronic
1042337581 8:67644683-67644705 ATTGATGAGCAGTGAAGAAGGGG + Intronic
1042735820 8:71987291-71987313 GTTGATGAGGGGTTGGGAAATGG + Intronic
1045533093 8:103002703-103002725 CTTGTTGAGCAGTAGTGAAGGGG - Intergenic
1049241036 8:141537441-141537463 GTTGAAGAGCAGTTGGGAGCTGG + Intergenic
1049609089 8:143544585-143544607 CTTGATGAGCAGTTGTGCAGTGG + Intergenic
1050739066 9:8799500-8799522 GTTGACAGGCAGTAGGGAAGAGG + Intronic
1055899264 9:81216180-81216202 GTGGATGAGCAGAAGGGAAAAGG + Intergenic
1056227424 9:84509813-84509835 ATTGATGAGGAGTCGGGCAATGG + Intergenic
1057264360 9:93604157-93604179 GTTGATGTGTGGTAGGGAAGAGG + Intronic
1060041474 9:120304899-120304921 GACGATGGGCAGCCGGGAAGAGG - Intergenic
1060824581 9:126680624-126680646 TTTGATGAGCAGGTGGGAGGAGG + Intronic
1061705342 9:132448899-132448921 TATTATGAGCAGTCGGGGAGTGG + Intronic
1185763144 X:2703768-2703790 GGAGATCAGCAGTCGGGGAGTGG + Intronic
1188869670 X:35358899-35358921 GGTGATGAGCAGTGGGGGATGGG + Intergenic
1192658816 X:73021545-73021567 GATGATGAGCGGCCGGGCAGAGG + Intergenic
1193743599 X:85247295-85247317 GCTGATGAGCCATAGGGAAGTGG - Intronic
1194420602 X:93668805-93668827 GTGGAGGAGCAGTCTGGAGGAGG + Intergenic
1195681075 X:107547106-107547128 ATTGATGAGCAGAGGGGAAAAGG + Intronic