ID: 994102397

View in Genome Browser
Species Human (GRCh38)
Location 5:95908275-95908297
Sequence GGGACGGTACCTGCCTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994102397_994102402 1 Left 994102397 5:95908275-95908297 CCTGAAAAGGCAGGTACCGTCCC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 994102402 5:95908299-95908321 TTTCACAGATGAGAAAACTGAGG 0: 68
1: 822
2: 3801
3: 9908
4: 17795
994102397_994102403 11 Left 994102397 5:95908275-95908297 CCTGAAAAGGCAGGTACCGTCCC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 994102403 5:95908309-95908331 GAGAAAACTGAGGCTTTTAATGG 0: 1
1: 2
2: 41
3: 325
4: 1772
994102397_994102404 12 Left 994102397 5:95908275-95908297 CCTGAAAAGGCAGGTACCGTCCC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 994102404 5:95908310-95908332 AGAAAACTGAGGCTTTTAATGGG 0: 1
1: 0
2: 1
3: 69
4: 444
994102397_994102405 25 Left 994102397 5:95908275-95908297 CCTGAAAAGGCAGGTACCGTCCC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 994102405 5:95908323-95908345 TTTTAATGGGATATGCTCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 169
994102397_994102406 26 Left 994102397 5:95908275-95908297 CCTGAAAAGGCAGGTACCGTCCC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 994102406 5:95908324-95908346 TTTAATGGGATATGCTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994102397 Original CRISPR GGGACGGTACCTGCCTTTTC AGG (reversed) Intronic