ID: 994102397

View in Genome Browser
Species Human (GRCh38)
Location 5:95908275-95908297
Sequence GGGACGGTACCTGCCTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994102397_994102404 12 Left 994102397 5:95908275-95908297 CCTGAAAAGGCAGGTACCGTCCC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 994102404 5:95908310-95908332 AGAAAACTGAGGCTTTTAATGGG 0: 1
1: 0
2: 1
3: 69
4: 444
994102397_994102403 11 Left 994102397 5:95908275-95908297 CCTGAAAAGGCAGGTACCGTCCC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 994102403 5:95908309-95908331 GAGAAAACTGAGGCTTTTAATGG 0: 1
1: 2
2: 41
3: 325
4: 1772
994102397_994102402 1 Left 994102397 5:95908275-95908297 CCTGAAAAGGCAGGTACCGTCCC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 994102402 5:95908299-95908321 TTTCACAGATGAGAAAACTGAGG 0: 68
1: 822
2: 3801
3: 9908
4: 17795
994102397_994102405 25 Left 994102397 5:95908275-95908297 CCTGAAAAGGCAGGTACCGTCCC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 994102405 5:95908323-95908345 TTTTAATGGGATATGCTCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 169
994102397_994102406 26 Left 994102397 5:95908275-95908297 CCTGAAAAGGCAGGTACCGTCCC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 994102406 5:95908324-95908346 TTTAATGGGATATGCTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994102397 Original CRISPR GGGACGGTACCTGCCTTTTC AGG (reversed) Intronic
902796606 1:18804546-18804568 GTGAAGGTACCTCCCTTCTCTGG - Intergenic
906252442 1:44321119-44321141 GGGAGGATACCTGGCTTTCCTGG - Intronic
907806297 1:57823724-57823746 GGGAGGGTAACTGCCATTTTTGG + Intronic
920919966 1:210290754-210290776 TGCACGGCACCTGCCTTCTCAGG + Intergenic
1072536518 10:96368533-96368555 GGGATAGTACCTGCCTTATAAGG - Intronic
1073356713 10:102860802-102860824 GGCACGGGCCCTGCCTTTACAGG - Intronic
1073959163 10:108906103-108906125 GGGTTGTTATCTGCCTTTTCTGG + Intergenic
1074854167 10:117461225-117461247 GAGACAGTTCCTGCCTTCTCTGG - Intergenic
1076545896 10:131245663-131245685 GGGAAGGTCCCTGCCTGTTCTGG - Intronic
1076688152 10:132207425-132207447 AGGCCGGTGCCTGCCGTTTCTGG - Intergenic
1076724807 10:132408383-132408405 GCGGGGGTACCTGCCTTTCCTGG + Intronic
1077445527 11:2588891-2588913 GGGAAGGTCACTGCCTTTTTTGG + Intronic
1077456099 11:2681789-2681811 GGTACAGTCCCTGCCTTCTCAGG + Intronic
1104520175 12:129466989-129467011 GGGACTGTTCCTGCCTTTTAAGG - Intronic
1111797368 13:92939536-92939558 GTGACGGTACCTGCCTTACAGGG + Intergenic
1111799900 13:92968642-92968664 GGGAGGGCACCTTCCATTTCTGG + Intergenic
1113835888 13:113328250-113328272 GGGACGGCACCTGCCTGGCCAGG + Intronic
1118889604 14:69897116-69897138 GGGGCAGTGCCTGGCTTTTCTGG + Intronic
1202935427 14_KI270725v1_random:83325-83347 TGGGCGGTACCTGCCTATTGTGG + Intergenic
1124051583 15:26201543-26201565 GTGACAGTTCCTGCATTTTCAGG - Intergenic
1125723825 15:41857963-41857985 GGGTCAGGACCTGCCTTTGCAGG + Intronic
1126338872 15:47617749-47617771 GGGATGGTACCTACCTCTTAGGG + Intronic
1129481244 15:75828131-75828153 GGGAAGCTATCTGTCTTTTCTGG + Intergenic
1132490495 16:227225-227247 GGGACGGTAGGTGCATTTTGGGG - Exonic
1133460948 16:5985619-5985641 GGGGGAGCACCTGCCTTTTCTGG + Intergenic
1135882359 16:26270403-26270425 GTGACGGTACCTGCCTCATTGGG - Intergenic
1147879786 17:43646185-43646207 GGGTCTGGACCTGCCTTCTCCGG - Intronic
1150637893 17:66929034-66929056 GGGAAGTTACCATCCTTTTCTGG - Intergenic
1151025141 17:70669245-70669267 GGGACCATACCTGCCTATTGTGG + Intergenic
1160709044 19:542353-542375 GGGACGGGAGCTGCCTCTGCAGG + Intergenic
1167053833 19:47096359-47096381 GGGAAGGCACCTCCCTTGTCAGG - Intronic
1168006951 19:53497956-53497978 TGGACAATACCTGGCTTTTCTGG - Intergenic
934305796 2:91820965-91820987 TGGGCGGTACCTGCCTATTGTGG - Intergenic
934327460 2:92031777-92031799 TGGGCGGTACCTGCCTATTGTGG + Intergenic
934465846 2:94262357-94262379 TGGGCGGTACCTGCCTATTGTGG + Intergenic
937375040 2:121330422-121330444 GGGAGAGTAACTGCCTGTTCGGG - Intergenic
941385165 2:164842257-164842279 GGGAGGTTACCTGCCTTGCCAGG + Intronic
947813460 2:233020472-233020494 GGGATGGTGCCTGGCTTTCCAGG - Intergenic
1169247443 20:4034625-4034647 TGGACGGTGCCTGGCTTTCCTGG + Intergenic
1171201984 20:23249540-23249562 GAGTCAGTGCCTGCCTTTTCTGG + Intergenic
1176596847 21:8705561-8705583 TGGGCGGTACCTGCCTATTGTGG + Intergenic
1180279767 22:10683003-10683025 TGGGCGGTACCTGCCTATTGTGG + Intergenic
954870791 3:53766170-53766192 GGAATGGTCCCTGCCTTTTAAGG + Intronic
960860418 3:122147189-122147211 AGGCCCGTTCCTGCCTTTTCAGG - Intergenic
967176564 3:186866129-186866151 TGGACGGTGCCTGGCTTTCCTGG + Intergenic
969514295 4:7638020-7638042 GGGGCTGGACCTGCCATTTCTGG + Intronic
974762058 4:66289880-66289902 GGGACTGTACCTACATTTTTAGG - Intergenic
975823709 4:78297624-78297646 GGTAAGGTCCCTGACTTTTCTGG - Intronic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
986469657 5:8061091-8061113 AGAACGGAAGCTGCCTTTTCAGG - Intergenic
989568964 5:42927293-42927315 GGGGCGGGAACTGCTTTTTCAGG + Intergenic
994102397 5:95908275-95908297 GGGACGGTACCTGCCTTTTCAGG - Intronic
1000291789 5:159877697-159877719 GGGACAGTACCTACCTTATGGGG - Intergenic
1002260609 5:177991558-177991580 AGGAAGGGACCTGCCTCTTCTGG - Intergenic
1007903886 6:45439415-45439437 GGGGCTTTGCCTGCCTTTTCTGG + Intronic
1019177791 6:170169251-170169273 GGGATTGTTCCTGCCTGTTCGGG + Intergenic
1019177908 6:170169888-170169910 GGGATTGTTCCTGCCTGTTCGGG + Intergenic
1019177912 6:170169908-170169930 GGGATTGTTCCTGCCTGTTCGGG + Intergenic
1022947537 7:35302490-35302512 GGGACTGTTCCTCCCCTTTCAGG + Intergenic
1024222625 7:47300471-47300493 TGGAAGGTACCTGCCCTTGCTGG - Intronic
1028985332 7:97004983-97005005 GGCTCGGTCCCTGCCGTTTCAGG - Intergenic
1030396613 7:108994576-108994598 GAGAAGGTATCTACCTTTTCAGG + Intergenic
1034963092 7:155374368-155374390 GGGCCGGGACCCGGCTTTTCCGG + Intergenic
1035906419 8:3515255-3515277 AGCACTGTACCTGCTTTTTCTGG + Intronic
1036655150 8:10672965-10672987 GGGACTGTGCCTGCCTCCTCTGG + Intronic
1039457615 8:37717918-37717940 TGCATGGTCCCTGCCTTTTCTGG - Intergenic
1044295332 8:90520563-90520585 GAGAAGATACCTGGCTTTTCAGG + Intergenic
1053942891 9:43270171-43270193 TGGGCGGTACCTGCCTATTGTGG + Intergenic
1058160958 9:101570245-101570267 GGGACGCTACCTTGCTTTTCTGG - Exonic
1058954435 9:109932172-109932194 GGGCCGGTGCCTGCCTTGTGTGG - Intronic
1061382472 9:130266510-130266532 GGGACGCTACGAGCCTTTGCAGG + Intergenic
1186517885 X:10180366-10180388 GGGACGGTATCTGACTTCTGAGG + Intronic
1187308088 X:18115298-18115320 GGGAAGGGACTTGCCTTTTGGGG - Intergenic
1187865333 X:23718525-23718547 GGCACAGGACCTGCCTTTTAGGG - Intronic
1193057097 X:77164454-77164476 GGGAAGGTAAATGTCTTTTCAGG - Intergenic