ID: 994102398

View in Genome Browser
Species Human (GRCh38)
Location 5:95908291-95908313
Sequence TTCTCATCTGTGAAAGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 979
Summary {0: 1, 1: 2, 2: 37, 3: 174, 4: 765}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994102398_994102405 9 Left 994102398 5:95908291-95908313 CCGTCCCCTTTCACAGATGAGAA 0: 1
1: 2
2: 37
3: 174
4: 765
Right 994102405 5:95908323-95908345 TTTTAATGGGATATGCTCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 169
994102398_994102404 -4 Left 994102398 5:95908291-95908313 CCGTCCCCTTTCACAGATGAGAA 0: 1
1: 2
2: 37
3: 174
4: 765
Right 994102404 5:95908310-95908332 AGAAAACTGAGGCTTTTAATGGG 0: 1
1: 0
2: 1
3: 69
4: 444
994102398_994102403 -5 Left 994102398 5:95908291-95908313 CCGTCCCCTTTCACAGATGAGAA 0: 1
1: 2
2: 37
3: 174
4: 765
Right 994102403 5:95908309-95908331 GAGAAAACTGAGGCTTTTAATGG 0: 1
1: 2
2: 41
3: 325
4: 1772
994102398_994102406 10 Left 994102398 5:95908291-95908313 CCGTCCCCTTTCACAGATGAGAA 0: 1
1: 2
2: 37
3: 174
4: 765
Right 994102406 5:95908324-95908346 TTTAATGGGATATGCTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994102398 Original CRISPR TTCTCATCTGTGAAAGGGGA CGG (reversed) Intronic