ID: 994102399

View in Genome Browser
Species Human (GRCh38)
Location 5:95908295-95908317
Sequence AGTTTTCTCATCTGTGAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 15267
Summary {0: 5, 1: 105, 2: 950, 3: 4027, 4: 10180}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994102399_994102408 30 Left 994102399 5:95908295-95908317 CCCCTTTCACAGATGAGAAAACT 0: 5
1: 105
2: 950
3: 4027
4: 10180
Right 994102408 5:95908348-95908370 AAAATCCTCACTTAGCATTTGGG 0: 1
1: 0
2: 2
3: 16
4: 237
994102399_994102405 5 Left 994102399 5:95908295-95908317 CCCCTTTCACAGATGAGAAAACT 0: 5
1: 105
2: 950
3: 4027
4: 10180
Right 994102405 5:95908323-95908345 TTTTAATGGGATATGCTCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 169
994102399_994102406 6 Left 994102399 5:95908295-95908317 CCCCTTTCACAGATGAGAAAACT 0: 5
1: 105
2: 950
3: 4027
4: 10180
Right 994102406 5:95908324-95908346 TTTAATGGGATATGCTCAAAGGG No data
994102399_994102404 -8 Left 994102399 5:95908295-95908317 CCCCTTTCACAGATGAGAAAACT 0: 5
1: 105
2: 950
3: 4027
4: 10180
Right 994102404 5:95908310-95908332 AGAAAACTGAGGCTTTTAATGGG 0: 1
1: 0
2: 1
3: 69
4: 444
994102399_994102403 -9 Left 994102399 5:95908295-95908317 CCCCTTTCACAGATGAGAAAACT 0: 5
1: 105
2: 950
3: 4027
4: 10180
Right 994102403 5:95908309-95908331 GAGAAAACTGAGGCTTTTAATGG 0: 1
1: 2
2: 41
3: 325
4: 1772
994102399_994102407 29 Left 994102399 5:95908295-95908317 CCCCTTTCACAGATGAGAAAACT 0: 5
1: 105
2: 950
3: 4027
4: 10180
Right 994102407 5:95908347-95908369 TAAAATCCTCACTTAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994102399 Original CRISPR AGTTTTCTCATCTGTGAAAG GGG (reversed) Intronic