ID: 994102400

View in Genome Browser
Species Human (GRCh38)
Location 5:95908296-95908318
Sequence CAGTTTTCTCATCTGTGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29680
Summary {0: 58, 1: 807, 2: 3532, 3: 9066, 4: 16217}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994102400_994102405 4 Left 994102400 5:95908296-95908318 CCCTTTCACAGATGAGAAAACTG 0: 58
1: 807
2: 3532
3: 9066
4: 16217
Right 994102405 5:95908323-95908345 TTTTAATGGGATATGCTCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 169
994102400_994102403 -10 Left 994102400 5:95908296-95908318 CCCTTTCACAGATGAGAAAACTG 0: 58
1: 807
2: 3532
3: 9066
4: 16217
Right 994102403 5:95908309-95908331 GAGAAAACTGAGGCTTTTAATGG 0: 1
1: 2
2: 41
3: 325
4: 1772
994102400_994102406 5 Left 994102400 5:95908296-95908318 CCCTTTCACAGATGAGAAAACTG 0: 58
1: 807
2: 3532
3: 9066
4: 16217
Right 994102406 5:95908324-95908346 TTTAATGGGATATGCTCAAAGGG No data
994102400_994102408 29 Left 994102400 5:95908296-95908318 CCCTTTCACAGATGAGAAAACTG 0: 58
1: 807
2: 3532
3: 9066
4: 16217
Right 994102408 5:95908348-95908370 AAAATCCTCACTTAGCATTTGGG 0: 1
1: 0
2: 2
3: 16
4: 237
994102400_994102404 -9 Left 994102400 5:95908296-95908318 CCCTTTCACAGATGAGAAAACTG 0: 58
1: 807
2: 3532
3: 9066
4: 16217
Right 994102404 5:95908310-95908332 AGAAAACTGAGGCTTTTAATGGG 0: 1
1: 0
2: 1
3: 69
4: 444
994102400_994102407 28 Left 994102400 5:95908296-95908318 CCCTTTCACAGATGAGAAAACTG 0: 58
1: 807
2: 3532
3: 9066
4: 16217
Right 994102407 5:95908347-95908369 TAAAATCCTCACTTAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994102400 Original CRISPR CAGTTTTCTCATCTGTGAAA GGG (reversed) Intronic