ID: 994102401

View in Genome Browser
Species Human (GRCh38)
Location 5:95908297-95908319
Sequence TCAGTTTTCTCATCTGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4540
Summary {0: 9, 1: 90, 2: 457, 3: 1295, 4: 2689}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994102401_994102408 28 Left 994102401 5:95908297-95908319 CCTTTCACAGATGAGAAAACTGA 0: 9
1: 90
2: 457
3: 1295
4: 2689
Right 994102408 5:95908348-95908370 AAAATCCTCACTTAGCATTTGGG 0: 1
1: 0
2: 2
3: 16
4: 237
994102401_994102405 3 Left 994102401 5:95908297-95908319 CCTTTCACAGATGAGAAAACTGA 0: 9
1: 90
2: 457
3: 1295
4: 2689
Right 994102405 5:95908323-95908345 TTTTAATGGGATATGCTCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 169
994102401_994102407 27 Left 994102401 5:95908297-95908319 CCTTTCACAGATGAGAAAACTGA 0: 9
1: 90
2: 457
3: 1295
4: 2689
Right 994102407 5:95908347-95908369 TAAAATCCTCACTTAGCATTTGG No data
994102401_994102406 4 Left 994102401 5:95908297-95908319 CCTTTCACAGATGAGAAAACTGA 0: 9
1: 90
2: 457
3: 1295
4: 2689
Right 994102406 5:95908324-95908346 TTTAATGGGATATGCTCAAAGGG No data
994102401_994102404 -10 Left 994102401 5:95908297-95908319 CCTTTCACAGATGAGAAAACTGA 0: 9
1: 90
2: 457
3: 1295
4: 2689
Right 994102404 5:95908310-95908332 AGAAAACTGAGGCTTTTAATGGG 0: 1
1: 0
2: 1
3: 69
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994102401 Original CRISPR TCAGTTTTCTCATCTGTGAA AGG (reversed) Intronic