ID: 994102403

View in Genome Browser
Species Human (GRCh38)
Location 5:95908309-95908331
Sequence GAGAAAACTGAGGCTTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2141
Summary {0: 1, 1: 2, 2: 41, 3: 325, 4: 1772}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994102399_994102403 -9 Left 994102399 5:95908295-95908317 CCCCTTTCACAGATGAGAAAACT 0: 5
1: 105
2: 950
3: 4027
4: 10180
Right 994102403 5:95908309-95908331 GAGAAAACTGAGGCTTTTAATGG 0: 1
1: 2
2: 41
3: 325
4: 1772
994102398_994102403 -5 Left 994102398 5:95908291-95908313 CCGTCCCCTTTCACAGATGAGAA 0: 1
1: 2
2: 37
3: 174
4: 765
Right 994102403 5:95908309-95908331 GAGAAAACTGAGGCTTTTAATGG 0: 1
1: 2
2: 41
3: 325
4: 1772
994102400_994102403 -10 Left 994102400 5:95908296-95908318 CCCTTTCACAGATGAGAAAACTG 0: 58
1: 807
2: 3532
3: 9066
4: 16217
Right 994102403 5:95908309-95908331 GAGAAAACTGAGGCTTTTAATGG 0: 1
1: 2
2: 41
3: 325
4: 1772
994102397_994102403 11 Left 994102397 5:95908275-95908297 CCTGAAAAGGCAGGTACCGTCCC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 994102403 5:95908309-95908331 GAGAAAACTGAGGCTTTTAATGG 0: 1
1: 2
2: 41
3: 325
4: 1772

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994102403 Original CRISPR GAGAAAACTGAGGCTTTTAA TGG Intronic