ID: 994102405

View in Genome Browser
Species Human (GRCh38)
Location 5:95908323-95908345
Sequence TTTTAATGGGATATGCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 169}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994102401_994102405 3 Left 994102401 5:95908297-95908319 CCTTTCACAGATGAGAAAACTGA 0: 9
1: 90
2: 457
3: 1295
4: 2689
Right 994102405 5:95908323-95908345 TTTTAATGGGATATGCTCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 169
994102400_994102405 4 Left 994102400 5:95908296-95908318 CCCTTTCACAGATGAGAAAACTG 0: 58
1: 807
2: 3532
3: 9066
4: 16217
Right 994102405 5:95908323-95908345 TTTTAATGGGATATGCTCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 169
994102398_994102405 9 Left 994102398 5:95908291-95908313 CCGTCCCCTTTCACAGATGAGAA 0: 1
1: 2
2: 37
3: 174
4: 765
Right 994102405 5:95908323-95908345 TTTTAATGGGATATGCTCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 169
994102397_994102405 25 Left 994102397 5:95908275-95908297 CCTGAAAAGGCAGGTACCGTCCC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 994102405 5:95908323-95908345 TTTTAATGGGATATGCTCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 169
994102399_994102405 5 Left 994102399 5:95908295-95908317 CCCCTTTCACAGATGAGAAAACT 0: 5
1: 105
2: 950
3: 4027
4: 10180
Right 994102405 5:95908323-95908345 TTTTAATGGGATATGCTCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994102405 Original CRISPR TTTTAATGGGATATGCTCAA AGG Intronic