ID: 994102407 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:95908347-95908369 |
| Sequence | TAAAATCCTCACTTAGCATT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 994102399_994102407 | 29 | Left | 994102399 | 5:95908295-95908317 | CCCCTTTCACAGATGAGAAAACT | 0: 5 1: 105 2: 950 3: 4027 4: 10180 |
||
| Right | 994102407 | 5:95908347-95908369 | TAAAATCCTCACTTAGCATTTGG | No data | ||||
| 994102400_994102407 | 28 | Left | 994102400 | 5:95908296-95908318 | CCCTTTCACAGATGAGAAAACTG | 0: 58 1: 807 2: 3532 3: 9066 4: 16217 |
||
| Right | 994102407 | 5:95908347-95908369 | TAAAATCCTCACTTAGCATTTGG | No data | ||||
| 994102401_994102407 | 27 | Left | 994102401 | 5:95908297-95908319 | CCTTTCACAGATGAGAAAACTGA | 0: 9 1: 90 2: 457 3: 1295 4: 2689 |
||
| Right | 994102407 | 5:95908347-95908369 | TAAAATCCTCACTTAGCATTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 994102407 | Original CRISPR | TAAAATCCTCACTTAGCATT TGG | Intronic | ||