ID: 994102407

View in Genome Browser
Species Human (GRCh38)
Location 5:95908347-95908369
Sequence TAAAATCCTCACTTAGCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994102400_994102407 28 Left 994102400 5:95908296-95908318 CCCTTTCACAGATGAGAAAACTG 0: 58
1: 807
2: 3532
3: 9066
4: 16217
Right 994102407 5:95908347-95908369 TAAAATCCTCACTTAGCATTTGG No data
994102401_994102407 27 Left 994102401 5:95908297-95908319 CCTTTCACAGATGAGAAAACTGA 0: 9
1: 90
2: 457
3: 1295
4: 2689
Right 994102407 5:95908347-95908369 TAAAATCCTCACTTAGCATTTGG No data
994102399_994102407 29 Left 994102399 5:95908295-95908317 CCCCTTTCACAGATGAGAAAACT 0: 5
1: 105
2: 950
3: 4027
4: 10180
Right 994102407 5:95908347-95908369 TAAAATCCTCACTTAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994102407 Original CRISPR TAAAATCCTCACTTAGCATT TGG Intronic